<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.1 20151215//EN" "https://jats.nlm.nih.gov/publishing/1.1/JATS-journalpublishing1.dtd">
<article article-type="research-article" dtd-version="1.1" specific-use="sps-1.7" xml:lang="en" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink">
	<front>
		<journal-meta>
			<journal-id journal-id-type="publisher-id">rbz</journal-id>
			<journal-title-group>
				<journal-title>Revista Brasileira de Zootecnia</journal-title>
				<abbrev-journal-title abbrev-type="publisher">R. Bras. Zootec.</abbrev-journal-title>
			</journal-title-group>
			<issn pub-type="ppub">1516-3598</issn>
			<issn pub-type="epub">1806-9290</issn>
			<publisher>
				<publisher-name>Sociedade Brasileira de Zootecnia</publisher-name>
			</publisher>
		</journal-meta>
		<article-meta>
			<article-id pub-id-type="other">00511</article-id>
			<article-id pub-id-type="doi">10.1590/rbz4720170015</article-id>
			<article-categories>
				<subj-group subj-group-type="heading">
					<subject>Non-Ruminants</subject>
				</subj-group>
			</article-categories>
			<title-group>
				<article-title>Effect of different vitamin D<sub>3</sub> metabolites on intestinal calcium homeostasis-related gene expression in broiler chickens</article-title>
			</title-group>
			<contrib-group>
				<contrib contrib-type="author">
					<name>
						<surname>Hsiao</surname>
						<given-names>Felix Shih-Hsiang</given-names>
					</name>
					<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
				</contrib>
				<contrib contrib-type="author">
					<name>
						<surname>Cheng</surname>
						<given-names>Yeong-Hsiang</given-names>
					</name>
					<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
				</contrib>
				<contrib contrib-type="author">
					<name>
						<surname>Han</surname>
						<given-names>Jin-Cheng</given-names>
					</name>
					<xref ref-type="aff" rid="aff3"><sup>3</sup></xref>
				</contrib>
				<contrib contrib-type="author">
					<name>
						<surname>Chang</surname>
						<given-names>Ming-Huang</given-names>
					</name>
					<xref ref-type="aff" rid="aff4"><sup>4</sup></xref>
				</contrib>
				<contrib contrib-type="author">
					<name>
						<surname>Yu</surname>
						<given-names>Yu-Hsiang</given-names>
					</name>
					<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
					<xref ref-type="corresp" rid="c1">*</xref>
				</contrib>
				<aff id="aff1">
					<label>1</label>
					<institution content-type="orgname">Tunghai University</institution>
					<institution content-type="orgdiv1">Department of Animal Science and Biotechnology</institution>
					<addr-line>
						<named-content content-type="city">Taichung</named-content>
					</addr-line>
					<country country="TW">Taiwan</country>
					<institution content-type="original">Tunghai University, Department of Animal Science and Biotechnology, Taichung, Taiwan</institution>
				</aff>
				<aff id="aff2">
					<label>2</label>
					<institution content-type="orgname">National Ilan University</institution>
					<institution content-type="orgdiv1">Department of Biotechnology and Animal Science</institution>
					<addr-line>
						<named-content content-type="city">I-Lan</named-content>
					</addr-line>
					<country country="TW">Taiwan</country>
					<institution content-type="original">National Ilan University, Department of Biotechnology and Animal Science, I-Lan, Taiwan</institution>
				</aff>
				<aff id="aff3">
					<label>3</label>
					<institution content-type="orgname">Shangqiu Normal University</institution>
					<institution content-type="orgdiv1">Department of Animal Science</institution>
					<addr-line>
						<named-content content-type="city">Shangqiu</named-content>
						<named-content content-type="state">Henan</named-content>
					</addr-line>
					<country country="CN">China</country>
					<institution content-type="original">Shangqiu Normal University, Department of Animal Science, Shangqiu, Henan, China</institution>
				</aff>
				<aff id="aff4">
					<label>4</label>
					<institution content-type="orgname">National Chia-Yi University</institution>
					<institution content-type="orgdiv1">Department of Veterinary Medicine</institution>
					<addr-line>
						<named-content content-type="city">Chia-Yi</named-content>
					</addr-line>
					<country country="TW">Taiwan</country>
					<institution content-type="original">National Chia-Yi University, Department of Veterinary Medicine, Chia-Yi, Taiwan</institution>
				</aff>
			</contrib-group>
			<author-notes>
				<corresp id="c1">
					<label>*</label><bold>Corresponding author:</bold><email>yuyh@niu.edu.tw</email>
				</corresp>
			</author-notes>
			<pub-date pub-type="epub">
				<day>11</day>
				<month>5</month>
				<year>2018</year>
			</pub-date>
			<volume>47</volume>
			<elocation-id>e20170015</elocation-id>
			<history>
				<date date-type="received">
					<day>02</day>
					<month>02</month>
					<year>2017</year>
				</date>
				<date date-type="accepted">
					<day>19</day>
					<month>10</month>
					<year>2017</year>
				</date>
			</history>
			<permissions>
				<license license-type="open-access" xlink:href="https://creativecommons.org/licenses/by/4.0/" xml:lang="en">
					<license-p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
				</license>
			</permissions>
			<abstract>
				<title>ABSTRACT</title>
				<p>The purpose of this study was to investigate the effects of vitamin D<sub>3</sub> metabolites 1α-hydroxycholecalciferol (1α(OH)D<sub>3</sub>), 25-hydroxycholecalciferol (25(OH)<sub>2</sub>D<sub>3</sub>), and 1,25-dihydroxycholecalciferol (1,25(OH)<sub>2</sub>D<sub>3</sub>) on growth performance, bone quality, and intestinal calcium homeostasis-related gene expression in broiler chickens. One-day-old broilers were fed a basal diet and basal diet containing different vitamin D<sub>3</sub> metabolites. The body weight, feed intake, and feed conversion ratio in control and experimental broilers were measured to assess the growth performance, mineral levels, and bone breaking strength. The duodenum was used to assess calcium homeostasis-related gene expressions by quantitative reverse transcription-PCR. No statistically significant difference was found in growth performance, mineral deposition, or bone breaking strength in broiler chickens after three weeks feeding with vitamin D<sub>3</sub>. However, supplementation of vitamin D<sub>3</sub> metabolites tended to improve feed conversion rate, bone mineral deposition, and breaking strength in broiler chickens. The results demonstrated that vitamin D<sub>3</sub> metabolites significantly upregulated calcium homeostasis-related genes, including calbindin, β-glucuronidase, TRPV6, and Na/Pi IIb cotransporter, mRNA levels after 12 h of feeding. The vitamin D<sub>3</sub> metabolite 1,25(OH)<sub>2</sub>D<sub>3</sub> was the most effective at regulating calcium homeostasis-associated gene expression after 6 h of feeding. Dietary vitamin D3 metabolites may alleviate the development of TD in broiler chickens and these effects probably occur through regulation of intestinal calcium homeostasis-related gene expression.</p>
			</abstract>
			<kwd-group xml:lang="en">
				<title>Key Words:</title>
				<kwd>gene</kwd>
				<kwd>1α-hydroxycholecalciferol</kwd>
				<kwd>25-hydroxycholecalciferol</kwd>
				<kwd>1,25-dihydroxycholecalciferol</kwd>
			</kwd-group>
			<funding-group>
				<award-group>
					<funding-source>Ministry of Science and Technology</funding-source>
					<award-id>NSC 99-2324-B-197-007</award-id>
				</award-group>
			</funding-group>
			<counts>
				<fig-count count="2"/>
				<table-count count="4"/>
				<equation-count count="0"/>
				<ref-count count="38"/>
			</counts>
		</article-meta>
	</front>
	<body>
		<sec sec-type="intro">
			<title>Introduction</title>
			<p>Tibial dyschondroplasia (TD) is an extremely common skeletal abnormality associated with rapid growth rate in broiler chickens (<xref ref-type="bibr" rid="B26">Leach and Lilburn, 1992</xref>). It leads to enormous economic losses worldwide and to animal welfare problems (<xref ref-type="bibr" rid="B32">Pines et al., 2005</xref>). Tibial dyschondroplasia is characterized by the formation of a lesion composed of non-vascularized, non-mineralized cartilage that extends from the epiphyseal growth plate into the metaphysic (<xref ref-type="bibr" rid="B27">Leach and Nesheim, 1965</xref>). It has been reported that TD is influenced by several factors, including genetics and nutrition (<xref ref-type="bibr" rid="B37">Waldenstedt, 2006</xref>). Nutrition plays a major role in the development and maintenance of bone structure, such as calcium, phosphorus, and vitamin D (<xref ref-type="bibr" rid="B12">Fleming, 2008</xref>). Vitamin D<sub>3</sub> (cholecalciferol) has been widely used as a feed additive to improve calcium and phosphorus metabolism and bone development in poultry (<xref ref-type="bibr" rid="B5">Baker et al., 1998</xref>). It has also been demonstrated that supplementation of vitamin D metabolites could efficiently prevent TD in broiler chickens (<xref ref-type="bibr" rid="B10">Edwards, 1990</xref>; <xref ref-type="bibr" rid="B33">Roberson and Edwards, 1996</xref>; <xref ref-type="bibr" rid="B36">Whitehead et al., 2004</xref>).</p>
			<p>Conversion of vitamin D<sub>3</sub> to 25-hydroxycholecalciferol (25(OH)D<sub>3</sub>) is catalyzed by 25-hydroxylase in livers. 25(OH)D<sub>3</sub> is further converted to 1,25-dihydroxycholecalciferol (1,25(OH)<sub>2</sub>D<sub>3</sub>) by 1α-hydroxylase in kidney. 1,25(OH)<sub>2</sub>D<sub>3</sub> is the biologically active form of vitamin D <italic>in vivo</italic> (<xref ref-type="bibr" rid="B18">Henry et al., 1979</xref>; <xref ref-type="bibr" rid="B19">Henry et al., 1985</xref>). It has been shown that 25(OH)D<sub>3</sub> significantly improved body weight and feed efficiency of broiler chickens compared with those of the birds fed vitamin D<sub>3</sub> (<xref ref-type="bibr" rid="B38">Yarger et al., 1995</xref>; <xref ref-type="bibr" rid="B13">Fritts and Waldroup, 2003</xref>; <xref ref-type="bibr" rid="B24">Koreleski and Swiatkiewicz, 2005</xref>). Recently, we also demonstrated that broilers fed 1α-hydroxycholecalciferol (1α(OH)D<sub>3</sub>) had higher body weight gain, feed intake, and tibia breaking strength compared with birds fed 25(OH)D<sub>3</sub> at 42 days of age (<xref ref-type="bibr" rid="B15">Han et al., 2016</xref>). However, no significant effects were found on body weight or feed efficiency in broiler chickens after supplementation of diet with 1,25(OH)<sub>2</sub>D<sub>3</sub> (<xref ref-type="bibr" rid="B33">Roberson and Edwards, 1996</xref>).</p>
			<p>Vitamin D<sub>3</sub> is involved in the regulation of levels of minerals such as calcium and phosphorous. Several mechanisms have been proposed to elucidate the vitamin D<sub>3</sub> metabolism and mechanisms of calcium transport in the small intestine (<xref ref-type="bibr" rid="B30">Norman et al., 1982</xref>; <xref ref-type="bibr" rid="B25">Kumar, 1990</xref>). However, little is known about the transcriptional level of intestinal calcium homeostasis-related genes in response to different vitamin D<sub>3</sub> metabolites in broiler chickens. Therefore, the present study was conducted to investigate the effects of different vitamin D metabolites including 1α(OH)D<sub>3</sub>, 25(OH)D<sub>3</sub>, and 1,25(OH)<sub>2</sub>D<sub>3</sub> on intestinal calcium homeostasis-related gene expression in broiler chickens.</p>
		</sec>
		<sec sec-type="materials|methods">
			<title>Material and Methods</title>
			<p>All experiments were performed in accordance with approved guidelines. The animal protocol was approved by local Institutional Animal Care and Use Committee (IACUC case No. 104-14). The concentration of vitamin D metabolites described earlier (<xref ref-type="bibr" rid="B38">Yarger et al., 1995</xref>; <xref ref-type="bibr" rid="B33">Roberson and Edwards, 1996</xref>; <xref ref-type="bibr" rid="B8">Chou et al., 2009</xref>; <xref ref-type="bibr" rid="B16">Han et al., 2009</xref>) was used in the present study. For examination of growth performance, mineral levels, and breaking strength, forty-eight one-day-old broilers (Avian) were randomly allocated to four different treatment groups (n = 12 per group) that were fed: basal diet (control), basal diet plus 5 μg/kg of 1α(OH)D<sub>3</sub>, basal diet plus 69 μg/kg of 25(OH)D<sub>3</sub>, and basal diet plus 5 μg/kg of 1,25(OH)<sub>2</sub>D<sub>3</sub>. The basal diets were formulated based on National Research Council recommendations (<xref ref-type="bibr" rid="B31">NRC, 1994</xref>) (<xref ref-type="table" rid="t1">Table 1</xref>). Water and feed was provided <italic>ad libitum</italic> over the entire experimental period. Total individual body weight, feed intake, and feed conversion ratio were recorded every week. At the end of the experiment, broilers were sacrificed by cervical dislocation. The blood was collected and centrifuged to harvest serum for biochemistry. The left tibia was removed for determination of mineral deposition and breaking strength measurement. For examination of calcium homeostasis-related gene expression, sixteen one-day-old broilers (Avian) were randomly allocated to four different treatment groups (n = 4 per group): basal diet (control), basal diet plus 5 μg/kg of 1α(OH)D<sub>3</sub>, basal diet plus 69 μg/kg of 25(OH)D<sub>3</sub>, and basal diet plus 5 μg/kg of 1,25(OH)<sub>2</sub>D<sub>3</sub>. After 0, 6, and 12 h of feeding, the duodenum was excised for RNA extraction.</p>
			<table-wrap id="t1">
				<label>Table 1</label>
				<caption>
					<title>Nutrient composition of basal diet</title>
				</caption>
				<table frame="hsides" rules="groups">
					<colgroup width="49%">
						<col width="1%"/>
						<col/>
						<col/>
					</colgroup>
					<thead style="border-top: thin solid; border-bottom: thin solid; border-color: #000000">
						<tr>
							<th align="left" colspan="2">Ingredient (g/kg)</th>
							<th align="center"/>
						</tr>
					</thead>
					<tbody style="border-bottom: thin solid; border-color: #000000">
						<tr>
							<td align="center"/>
							<td align="left">Corn</td>
							<td align="center">608.7</td>
						</tr>
						<tr>
							<td align="center"/>
							<td align="left">Soybean meal (43% CP)</td>
							<td align="center">320.0</td>
						</tr>
						<tr>
							<td align="center"/>
							<td align="left">Soybean oil</td>
							<td align="center">15.0</td>
						</tr>
						<tr>
							<td align="center"/>
							<td align="left">Soy protein isolate</td>
							<td align="center">34.1</td>
						</tr>
						<tr>
							<td align="center"/>
							<td align="left">Dicalcium phophate</td>
							<td align="center">13.1</td>
						</tr>
						<tr>
							<td align="center"/>
							<td align="left">L-lysine HCl</td>
							<td align="center">1.4</td>
						</tr>
						<tr>
							<td align="center"/>
							<td align="left">DL-methionine</td>
							<td align="center">1.4</td>
						</tr>
						<tr>
							<td align="center"/>
							<td align="left">Trace mineral premix<xref ref-type="table-fn" rid="TFN2">1</xref>
							</td>
							<td align="center">1.0</td>
						</tr>
						<tr>
							<td align="center"/>
							<td align="left">Vitamin premix<xref ref-type="table-fn" rid="TFN3">2</xref>
							</td>
							<td align="center">0.3</td>
						</tr>
						<tr>
							<td align="center"/>
							<td align="left">Choline chloride (50%)</td>
							<td align="center">2.0</td>
						</tr>
						<tr>
							<td align="center"/>
							<td align="left">Sodium chloride</td>
							<td align="center">3.0</td>
						</tr>
						<tr>
							<td align="left" colspan="2">Nutrient composition</td>
							<td align="center"/>
						</tr>
						<tr>
							<td align="center"/>
							<td align="left">Metabolizable energy (kcal/kg)</td>
							<td align="center">2972</td>
						</tr>
						<tr>
							<td align="center"/>
							<td align="left">Analyzed crude protein (g/kg)</td>
							<td align="center">205.8</td>
						</tr>
						<tr>
							<td align="center"/>
							<td align="left">Analyzed calcium (g/kg)</td>
							<td align="center">3.8</td>
						</tr>
						<tr>
							<td align="center"/>
							<td align="left">Analyzed total phosphorous (g/kg)</td>
							<td align="center">5.4</td>
						</tr>
						<tr>
							<td align="center"/>
							<td align="left">Non-phytate phosphorous (g/kg)</td>
							<td align="center">3.5</td>
						</tr>
						<tr>
							<td align="center"/>
							<td align="left">Lysine (g/kg)</td>
							<td align="center">11.0</td>
						</tr>
						<tr>
							<td align="center"/>
							<td align="left">Methionine (g/kg)</td>
							<td align="center">5.0</td>
						</tr>
					</tbody>
				</table>
				<table-wrap-foot>
					<fn id="TFN1">
						<p>CP - crude protein.</p>
					</fn>
					<fn id="TFN2">
						<label>1</label>
						<p>The trace mineral premix provided the following (per kg of diet): iron, 100 mg; zinc, 100 mg; copper, 8 mg; manganese, 120 mg; iodine, 0.7 mg; selenium, 0.3 mg.</p>
					</fn>
					<fn id="TFN3">
						<label>2</label>
						<p>The vitamin premix provided the following (per kg of diet): vitamin A, 8,000 IU; vitamin E, 20 IU; menadione, 0.5 mg; thiamine, 2.0 mg; riboflavin, 8.0 mg; niacin, 35 mg; pyridoxine, 3.5 mg; vitamin B12, 0.01 mg; pantothenic acid, 10.0 mg; folic acid, 0.55 mg; biotin, 0.18 mg.</p>
					</fn>
				</table-wrap-foot>
			</table-wrap>
			<p>Tissue RNA was extracted from the duodenum of broilers using TRIzol (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions and resuspended in diethyl pyrocarbonate-treated water. Reverse transcription was performed with a Transcriptor Reverse Transcriptase kit (Roche Applied Science, Indianapolis, IN, USA). Quantitative reverse transcriptase-polymerase chain reaction (PCR) for each gene (<xref ref-type="table" rid="t2">Table 2</xref>) was performed using Miniopticon Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA) and KAPA SYBR FAST qPCR Kit (Kapa Biosystems, Boston, MA, USA). Polymerase chain reaction was performed by 40 cycles at 95 °C for 30 s, 58-60 °C for 60 s, and 72 °C for 30s. Beta-actin mRNA was determined as the internal control gene. The mRNA expression of each gene was normalized to its β-actin mRNA expression in the same sample. Threshold cycle (Ct) values were obtained and relative gene expression was calculated using the formula: (1/2)Ct target genes-Ct β-actin.</p>
			<table-wrap id="t2">
				<label>Table 2</label>
				<caption>
					<title>Primer sequences for quantitative reverse transcription-PCR</title>
				</caption>
				<table frame="hsides" rules="groups">
					<colgroup width="33%">
						<col/>
						<col/>
						<col/>
					</colgroup>
					<thead style="border-top: thin solid; border-bottom: thin solid; border-color: #000000">
						<tr>
							<th align="left">Gene</th>
							<th align="center">Primer sequence (5′to3′)</th>
							<th align="center">Product size</th>
						</tr>
					</thead>
					<tbody style="border-bottom: thin solid; border-color: #000000">
						<tr>
							<td align="left">Calbindin</td>
							<td align="left">Forward: GGTCTTGGCATGTTATGGA<break/>Reverse: CGAACAAGCAGGTGAGAA</td>
							<td align="center">136 bp</td>
						</tr>
						<tr>
							<td align="left">β-glucuronidase</td>
							<td align="left">Forward: ACCTGTGGTGGCCTTATCTC<break/>Reverse: GTTGACCCCGTGGAAGTAGA</td>
							<td align="center">191 bp</td>
						</tr>
						<tr>
							<td align="left">TRPV6</td>
							<td align="left">Forward: CACAAGATGATGCGATACACAGAA<break/>Reverse: GCCTCGTGACAGTGATGGA</td>
							<td align="center">135 bp</td>
						</tr>
						<tr>
							<td align="left">Na/Pi llb</td>
							<td align="left">Forward: TGTCACAATTCCACCTTCAGAGA<break/>Reverse:AAGTATGAGACCGATGGCAAGAT</td>
							<td align="center">166 bp</td>
						</tr>
						<tr>
							<td align="left">24-hydroxylase</td>
							<td align="left">Forward: AACATTTCACGCAATCCACA<break/>Reverse: AATGGCACAGATGGTGTCAA</td>
							<td align="center">158 bp</td>
						</tr>
						<tr>
							<td align="left">VDR</td>
							<td align="left">Forward: CGTGAGAAGCAAATTCAGCA<break/>Reverse: GAGGTCCAGGTTGGAAAACA</td>
							<td align="center">157 bp</td>
						</tr>
						<tr>
							<td align="left">β-actin</td>
							<td align="left">Forward: CCACCGCAAATGCTTCTAAAC<break/>Reverse: GAAGGTGTCAGCAGTCTT</td>
							<td align="center">175 bp</td>
						</tr>
					</tbody>
				</table>
				<table-wrap-foot>
					<fn id="TFN4">
						<p>PCR - polymerase chain reaction; VDR - vitamin D receptor.</p>
					</fn>
				</table-wrap-foot>
			</table-wrap>
			<p>The left tibias were collected, cleaned of adhering tissue, weighed, dried to constant weight at 105 °C, defatted, and then ashed in a muffle furnace at 600 °C. Ash was dissolved in concentrated HCl for mineral determination. Calcium and phosphorus content was measured by atomic absorption spectrophotometry (<xref ref-type="bibr" rid="B1">AOAC, 1995a</xref>,<xref ref-type="bibr" rid="B2">b</xref>). Tibia breaking strength (breaking force divided by bone weight) was measured using TA.XT plus Texture Analyser (Mason Technology, Dublin, Ireland) with the use of a probe (HDP/3PB). Tibia was placed at the central position with 10 cm clearance, allowing the comparison of breaking strength values.</p>
			<p>Data were subjected to one-way ANOVA using the General Linear Model procedure of SAS statistical package (Statistical Analysis System, version 9.2) for completely randomized designs. Duncan's new multiple range test was used to evaluate differences between means (<xref ref-type="bibr" rid="B35">SAS Institute, 2008</xref>). P-values ≤ 0.05 were considered statistically significant.</p>
		</sec>
		<sec sec-type="results">
			<title>Results</title>
			<p>To examine the effect of vitamin D<sub>3</sub> metabolites on growth performance and bone quality, broilers were fed different vitamin D<sub>3</sub> metabolites (1α(OH)D<sub>3</sub>, 25(OH)D<sub>3</sub>, and 1,25(OH)<sub>2</sub>D<sub>3</sub>) for three weeks. However, there were no statistically confirmed differences between the growth performance and vitamin D<sub>3</sub> metabolite supplementation during the entire feeding period (<xref ref-type="table" rid="t3">Table 3</xref>). Although the changes in tibia calcium and phosphorus content were not statistically significant, a trend of increased tibia calcium and phosphorus content was observed with the supplementation of vitamin D<sub>3</sub> metabolites (<xref ref-type="table" rid="t4">Table 4</xref>). Dietary supplementation of vitamin D<sub>3</sub> metabolites had no significant effect on serum calcium and serum phosphorus content (<xref ref-type="table" rid="t4">Table 4</xref>). Although they did not reach statistical significance, vitamin D<sub>3</sub> metabolites caused a similar trend in increasing bone breaking strength in broiler chickens after feeding for three weeks (<xref ref-type="table" rid="t4">Table 4</xref>). These results indicate that supplementation of vitamin D<sub>3</sub> metabolites did not significantly improve growth performance and bone quality of broiler chickens.</p>
			<table-wrap id="t3">
				<label>Table 3</label>
				<caption>
					<title>Effect of different vitamin D<sub>3</sub> metabolites on growth performance of 21-day-old broilers</title>
				</caption>
				<table frame="hsides" rules="groups">
					<colgroup width="10%">
						<col/>
						<col/>
						<col/>
						<col/>
						<col/>
						<col/>
						<col/>
						<col/>
						<col/>
						<col/>
					</colgroup>
					<thead style="border-top: thin solid; border-bottom: thin solid; border-color: #000000">
						<tr>
							<th align="left" rowspan="2"/>
							<th align="center" colspan="2" style="border-bottom: thin solid; border-color: #000000">Control (n = 12)</th>
							<th align="center" colspan="2" style="border-bottom: thin solid; border-color: #000000">1α(OH)D<sub>3</sub> (n = 12)</th>
							<th align="center" colspan="2" style="border-bottom: thin solid; border-color: #000000">25(OH)D<sub>3</sub> (n = 12)</th>
							<th align="center" colspan="2" style="border-bottom: thin solid; border-color: #000000">1,25(OH)<sub>2</sub>D<sub>3</sub> (n = 12)</th>
							<th align="center" rowspan="2" valign="middle">P-value</th>
						</tr>
						<tr>
							<th align="center">Mean</th>
							<th align="center">SD</th>
							<th align="center">Mean</th>
							<th align="center">SD</th>
							<th align="center">Mean</th>
							<th align="center">SD</th>
							<th align="center">Mean</th>
							<th align="center">SD</th>
						</tr>
					</thead>
					<tbody style="border-bottom: thin solid; border-color: #000000">
						<tr>
							<td align="left">Initial body weight (g)</td>
							<td align="center">43</td>
							<td align="center">0.3</td>
							<td align="center">43</td>
							<td align="center">0.3</td>
							<td align="center">43</td>
							<td align="center">0.4</td>
							<td align="center">43</td>
							<td align="center">0.2</td>
							<td align="center">NS</td>
						</tr>
						<tr>
							<td align="left">Final body weight (g)</td>
							<td align="center">750</td>
							<td align="center">270</td>
							<td align="center">800</td>
							<td align="center">80</td>
							<td align="center">730</td>
							<td align="center">5</td>
							<td align="center">780</td>
							<td align="center">19</td>
							<td align="center">NS</td>
						</tr>
						<tr>
							<td align="left" colspan="10">0-21days</td>
						</tr>
						<tr>
							<td align="left">ADG (g/day)</td>
							<td align="center">35</td>
							<td align="center">2</td>
							<td align="center">38</td>
							<td align="center">1</td>
							<td align="center">34</td>
							<td align="center">0.4</td>
							<td align="center">37</td>
							<td align="center">2</td>
							<td align="center">NS</td>
						</tr>
						<tr>
							<td align="left">ADFI (g/day)</td>
							<td align="center">45</td>
							<td align="center">1</td>
							<td align="center">46</td>
							<td align="center">0.08</td>
							<td align="center">43</td>
							<td align="center">1</td>
							<td align="center">44</td>
							<td align="center">1</td>
							<td align="center">NS</td>
						</tr>
						<tr>
							<td align="left">FCR (gain/feed)</td>
							<td align="center">0.787</td>
							<td align="center">0.035</td>
							<td align="center">0.825</td>
							<td align="center">0.012</td>
							<td align="center">0.797</td>
							<td align="center">0.006</td>
							<td align="center">0.835</td>
							<td align="center">0.016</td>
							<td align="center">NS</td>
						</tr>
					</tbody>
				</table>
				<table-wrap-foot>
					<fn id="TFN5">
						<p>1α(OH)D<sub>3</sub> - 1α-hydroxycholecalciferol; 25(OH)D<sub>3</sub> - 25-hydroxycholecalciferol; 1,25(OH)<sub>2</sub>D<sub>3</sub> - 1,25-dihydroxycholecalciferol; ADG - average daily gain; ADFI - average daily feed intake; FCR - feed conversion ratio; SD - standard deviation; NS - no significant difference (P&gt;0.05).</p>
					</fn>
				</table-wrap-foot>
			</table-wrap>
			<table-wrap id="t4">
				<label>Table 4</label>
				<caption>
					<title>Effect of different vitamin D<sub>3</sub> metabolites on tibia, serum calcium, and phosphate levels and breaking strength in broilers</title>
				</caption>
				<table frame="hsides" rules="groups">
					<colgroup width="10%">
						<col/>
						<col/>
						<col/>
						<col/>
						<col/>
						<col/>
						<col/>
						<col/>
						<col/>
						<col/>
					</colgroup>
					<thead style="border-top: thin solid; border-bottom: thin solid; border-color: #000000">
						<tr>
							<th align="left" rowspan="2"/>
							<th align="center" colspan="2" style="border-bottom: thin solid; border-color: #000000">Control (n = 12)</th>
							<th align="center" colspan="2" style="border-bottom: thin solid; border-color: #000000">1α(OH)D<sub>3</sub> (n = 12)</th>
							<th align="center" colspan="2" style="border-bottom: thin solid; border-color: #000000">25(OH)D<sub>3</sub> (n = 12)</th>
							<th align="center" colspan="2" style="border-bottom: thin solid; border-color: #000000">1,25(OH)<sub>2</sub>D<sub>3</sub> (n = 12)</th>
							<th align="center" rowspan="2" valign="middle">P-value</th>
						</tr>
						<tr>
							<th align="center">Mean</th>
							<th align="center">SD</th>
							<th align="center">Mean</th>
							<th align="center">SD</th>
							<th align="center">Mean</th>
							<th align="center">SD</th>
							<th align="center">Mean</th>
							<th align="center">SD</th>
						</tr>
					</thead>
					<tbody style="border-bottom: thin solid; border-color: #000000">
						<tr>
							<td align="left">Calcium of bone (%)</td>
							<td align="center">13.00</td>
							<td align="center">2.36</td>
							<td align="center">14.24</td>
							<td align="center">1.89</td>
							<td align="center">14.62</td>
							<td align="center">2.71</td>
							<td align="center">13.37</td>
							<td align="center">0.83</td>
							<td align="center">NS</td>
						</tr>
						<tr>
							<td align="left">Phosphate of bone (%)</td>
							<td align="center">6.06</td>
							<td align="center">1.17</td>
							<td align="center">6.99</td>
							<td align="center">0.73</td>
							<td align="center">7.04</td>
							<td align="center">1.42</td>
							<td align="center">6.32</td>
							<td align="center">0.37</td>
							<td align="center">NS</td>
						</tr>
						<tr>
							<td align="left">Serum calcium (mg/dL)</td>
							<td align="center">8.77</td>
							<td align="center">0.17</td>
							<td align="center">9.60</td>
							<td align="center">0.83</td>
							<td align="center">9.13</td>
							<td align="center">0.24</td>
							<td align="center">8.58</td>
							<td align="center">0.40</td>
							<td align="center">NS</td>
						</tr>
						<tr>
							<td align="left">Serum phosphate (mg/dL)</td>
							<td align="center">8.58</td>
							<td align="center">1.07</td>
							<td align="center">8.67</td>
							<td align="center">0.26</td>
							<td align="center">7.60</td>
							<td align="center">0.08</td>
							<td align="center">8.67</td>
							<td align="center">0.19</td>
							<td align="center">NS</td>
						</tr>
						<tr>
							<td align="left">Breaking strength (N)</td>
							<td align="center">187.43</td>
							<td align="center">18.31</td>
							<td align="center">197.67</td>
							<td align="center">20.51</td>
							<td align="center">208.66</td>
							<td align="center">19.92</td>
							<td align="center">193.48</td>
							<td align="center">8.65</td>
							<td align="center">NS</td>
						</tr>
					</tbody>
				</table>
				<table-wrap-foot>
					<fn id="TFN6">
						<p>1α(OH)D<sub>3</sub> - 1α-hydroxycholecalciferol; 25(OH)D<sub>3</sub> - 25-hydroxycholecalciferol; 1,25(OH)<sub>2</sub>D<sub>3</sub> - 1,25-dihydroxycholecalciferol; SD - standard deviation; NS - no significant difference (P&gt;0.05).</p>
					</fn>
				</table-wrap-foot>
			</table-wrap>
			<p>To examine the effect of different vitamin D<sub>3</sub> metabolites on calcium homeostasis-related gene expression in the duodenum, broiler chickens were fed 5 μg/kg of 1α(OH)D<sub>3</sub>, 69 μg/kg of 25(OH)D<sub>3</sub>, and 5 μg/kg of 1,25(OH)<sub>2</sub>D<sub>3</sub> for 0, 6, and 12 h. The level of calbindin mRNA was rapidly increased at 6 h after feeding broiler chickens additional amounts of vitamin D<sub>3</sub> metabolites (<xref ref-type="fig" rid="f1">Figure 1A</xref>). Among vitamin D<sub>3</sub> metabolites, 1,25(OH)<sub>2</sub>D<sub>3</sub> appeared to be more efficient than 1α(OH)D<sub>3</sub> and 25(OH)D<sub>3</sub> at regulating calbindin mRNA expression at 6 and 12 h (<xref ref-type="fig" rid="f1">Figure 1A</xref>). The level of β-glucuronidase mRNA was induced at 6 h after feeding 1,25(OH)<sub>2</sub>D<sub>3</sub> compared with other vitamin D<sub>3</sub> metabolites (<xref ref-type="fig" rid="f1">Figure 1B</xref>). After 12 h of feeding, 1α(OH)D<sub>3</sub> and 25(OH)D<sub>3</sub> also promoted β-glucuronidase mRNA expression and 1,25(OH)<sub>2</sub>D<sub>3</sub> increased the β-glucuronidase mRNA even further (<xref ref-type="fig" rid="f1">Figure 1B</xref>). Similarly, 1,25(OH)<sub>2</sub>D<sub>3</sub> rapidly induced the level of transient receptor potential cation channel, subfamily V, member 6 (TRPV6) mRNA at 6 h (<xref ref-type="fig" rid="f1">Figure 1C</xref>). After 12 h of feeding, all vitamin D<sub>3</sub> metabolites exhibited increased TRPV6 mRNA expression (<xref ref-type="fig" rid="f1">Figure 1C</xref>). The level of type IIb sodium-dependent phosphate (Na/Pi IIb) cotransporter mRNA was rapidly increased at 6 and 12 h after feeding broiler chickens additional amounts of vitamin D<sub>3</sub> metabolites (<xref ref-type="fig" rid="f2">Figure 2A</xref>). The level of 24-hydroxylase mRNA was reduced at 12 h after feeding 25(OH)D<sub>3</sub> compared with the control diet (<xref ref-type="fig" rid="f2">Figure 2B</xref>). However, none of the vitamin D<sub>3</sub> metabolites changed the vitamin D receptor (VDR) mRNA levels in the duodenum of broilers (<xref ref-type="fig" rid="f2">Figure 2C</xref>). Taken together, these results indicate that vitamin D<sub>3</sub> metabolites were able to rapidly modulate calcium homeostasis-related gene expression in the duodenum and 1,25(OH)<sub>2</sub>D<sub>3</sub> was the most effective vitamin D<sub>3</sub> metabolite in regulating calcium homeostasis-associated genes.</p>
			<fig id="f1">
				<label>Figure 1</label>
				<caption>
					<title>Effects of different vitamin D<sub>3</sub> metabolites on duodenal (A) calbindin, (B) β-glucuronidase, and (C) TRPV6 gene expression in broilers.</title>
					<p>1α(OH)D<sub>3</sub> - 1α-hydroxycholecalciferol; 25(OH)D<sub>3</sub> - 25-hydroxycholecalciferol; 1,25(OH)<sub>2</sub>D<sub>3</sub> - 1,25-dihydroxycholecalciferol; TRPV6 - transient receptor potential cation channel, subfamily V, member 6.</p>
					<p>Values were expressed as mean ± standard deviation (n = 4).</p>
					<p>a-c - Means followed by different letters are significantly different (P&lt;0.05).</p>
				</caption>
				<graphic xlink:href="1806-9290-rbz-rbz4720170015-gf01.tif"/>
			</fig>
			<fig id="f2">
				<label>Figure 2</label>
				<caption>
					<title>Effects of different vitamin D<sub>3</sub> metabolites on duodenal (A) Na/Pi IIb, (B) 24-hydroxylase, and (C) VDR gene expression in broilers.</title>
					<p>1α(OH)D<sub>3</sub> - 1α-hydroxycholecalciferol; 25(OH)D<sub>3</sub> - 25-hydroxycholecalciferol; 1,25(OH)<sub>2</sub>D<sub>3</sub> - 1,25-dihydroxycholecalciferol; Na/Pi IIb - type IIb sodium-dependent phosphate; VDR - vitamin D receptor.</p>
					<p>Values were expressed as mean ± standard deviation (n = 4).</p>
					<p>a-c - Means followed by different letters are significantly different (P&lt;0.05).</p>
				</caption>
				<graphic xlink:href="1806-9290-rbz-rbz4720170015-gf02.tif"/>
			</fig>
		</sec>
		<sec sec-type="discussion">
			<title>Discussion</title>
			<p>In this study, we demonstrated that vitamin D<sub>3</sub> metabolites could rapidly regulate calcium homeostasis-related gene expression in the duodenum from 6-12 h after feeding, although the growth performance and bone quality of broiler chickens at 21 days of age were not significantly changed. Among these vitamin D<sub>3</sub> metabolites, 1,25(OH)<sub>2</sub>D<sub>3</sub> was the most effective in modulating calcium homeostasis-associated gene expression.</p>
			<p>It has been reported that feeding broilers 69 μg/kg of 25(OH)D<sub>3</sub> for three weeks did not affect body weight gain, feed conversion ratio, or feed intake (<xref ref-type="bibr" rid="B8">Chou et al., 2009</xref>). There were no significant effects on body weight or feed efficiency at 21 days of age in broiler chickens after supplementation of the diet with 1,25(OH)<sub>2</sub>D<sub>3</sub> (<xref ref-type="bibr" rid="B33">Roberson and Edwards, 1996</xref>). Similarly, our results also confirm the previous reports that no significant effects were observed on growth performance of broiler chickens at 21 days of age after supplementation of the diet with 1α(OH)D<sub>3</sub>, 25(OH)D<sub>3</sub>, or 1,25(OH)<sub>2</sub>D<sub>3</sub>. Furthermore, 1α(OH)D<sub>3</sub> did not alter bone breaking strength, tibia calcium, and phosphorus content in broiler chickens at 21 days of age (<xref ref-type="bibr" rid="B16">Han et al., 2009</xref>). Consistently, we also found that vitamin D<sub>3</sub> metabolites did not improve bone breaking strength and bone mineral deposition after feeding for three weeks. In contrast, broilers fed 6 μg/kg of 1,25(OH)<sub>2</sub>D<sub>3</sub> for three weeks exhibited significantly increased bone ash content (<xref ref-type="bibr" rid="B33">Roberson and Edwards, 1996</xref>). The contradiction may be due to the differences between composition of basal diet and chicken strains. Together, these findings demonstrate that vitamin D<sub>3</sub> metabolites do not have a significant effect on growth performance, but mineral deposition and bone breaking strength in broiler chickens may vary after feeding for three weeks.</p>
			<p>Calbindin is a vitamin D-induced calcium-binding protein that plays a key role in intestinal intracellular calcium transport. The expression of calbindin in the intestine and kidney has been shown to be regulated by 1,25(OH)<sub>2</sub>D<sub>3</sub> in rats and chickens (<xref ref-type="bibr" rid="B7">Brehier and Thomasset, 1990</xref>; <xref ref-type="bibr" rid="B14">Hall and Norman, 1990</xref>; <xref ref-type="bibr" rid="B11">Ferrari et al., 1992</xref>). Supplementation of 1,25(OH)<sub>2</sub>D<sub>3</sub> could induce calbindin mRNA expression in the duodenum of 1α-hydroxylase knockout mice (<xref ref-type="bibr" rid="B21">Hoenderop et al., 2004</xref>). Here, we further demonstrated that vitamin D<sub>3</sub> metabolites are able to induce intestinal calbindin mRNA expression <italic>in vivo</italic>. Particularly, the expression of calbindin peaked at 6 h and declined afterwards, 12 h after 1,25(OH)<sub>2</sub>D<sub>3</sub> treatment. The intestinal epithelial Ca<sup>2+</sup> channel, TRPV6, is primarily activated by β-glucuronidase. It has been found that β-glucuronidase secretion from isolated intestinal epithelial cells was remarkably increased by supplementation of 1,25(OH)<sub>2</sub>D<sub>3</sub> (<xref ref-type="bibr" rid="B23">Khanal et al., 2008</xref>). The intestinal TRPV6 gene expression was significantly increased after incubation for 6 h with 25(OH)D<sub>3</sub> or 1,25(OH)<sub>2</sub>D<sub>3</sub> (<xref ref-type="bibr" rid="B4">Balesaria et al., 2009</xref>). Supplementation of 1,25(OH)<sub>2</sub>D<sub>3</sub> significantly upregulated the TRPV6 mRNA expression in the duodenum of 1α-hydroxylase knockout mice (<xref ref-type="bibr" rid="B21">Hoenderop et al., 2004</xref>). Our findings further suggested that vitamin D<sub>3</sub> metabolites, including 1,25(OH)<sub>2</sub>D<sub>3</sub>, transcriptionally regulate β-glucuronidase and TRPV6 mRNA expression <italic>in vivo</italic>. The NaPi-IIb cotransporter is primarily expressed in the brush-border membranes of the small intestinal epithelium, where it is considered the major sodium-Pi cotransporter (<xref ref-type="bibr" rid="B20">Hilfiker et al., 1998</xref>). Dietary supplementation of 1,25(OH)<sub>2</sub>D<sub>3</sub> significantly regulates the expression of NaPi-IIb cotransporter in the intestine of rats (<xref ref-type="bibr" rid="B22">Katai et al., 1999</xref>). In broilers, 1α(OH)D<sub>3</sub> also has a similar effect on regulation of intestinal NaPi-IIb cotransporter gene expression (<xref ref-type="bibr" rid="B16">Han et al., 2009</xref>). Here, we also demonstrated that vitamin D<sub>3</sub> metabolites could rapidly induce the levels of NaPi-IIb cotransporter mRNA in the intestine of broiler chickens. Several genes associated with calcium homeostasis have been shown to be regulated by VDR, such as calbindin and TRPV6 (<xref ref-type="bibr" rid="B6">Bolt et al., 2005</xref>; <xref ref-type="bibr" rid="B28">Meyer et al., 2006</xref>). Since dietary 1,25(OH)<sub>2</sub>D<sub>3</sub> could be absorbed and bound to intestinal VDR and then regulate its downstream gene transcriptionally, we speculate that intestinal gene expression may be directly regulated by VDR in response to vitamin D<sub>3</sub> metabolites.</p>
			<p>The 24-hydroxylase belongs to cytochrome P450-containing enzyme (CYP24) that is important in the regulation of vitamin D metabolism (<xref ref-type="bibr" rid="B29">Minghetti and Norman, 1988</xref>). The expression of 24-hydroxylase in the kidney has been demonstrated to be regulated by 1,25(OH)<sub>2</sub>D<sub>3</sub> and to initiate the inactivation of 1,25(OH)<sub>2</sub>D<sub>3</sub> (<xref ref-type="bibr" rid="B3">Armbrecht et al., 1997</xref>). Interestingly, we found that intestinal 24-hydroxylase mRNA expression was reduced by dietary supplementation of 25(OH)D<sub>3</sub> in broiler chickens. However, 1α(OH)D<sub>3</sub> and 1,25(OH)<sub>2</sub>D<sub>3</sub> did not cause a significant effect on intestinal 24-hydroxylase mRNA expression. The metabolite 1,25(OH)<sub>2</sub>D<sub>3</sub> plays a central role in regulating mineral metabolism through direct interaction with intracellular VDR in intestinal and kidney epithelial cells (<xref ref-type="bibr" rid="B17">Haussler et al., 1998</xref>). It has been reported that vitamin D analogs auto-regulate the expression of the VDR gene expression in cultured kidney cells (<xref ref-type="bibr" rid="B9">Costa et al., 1985</xref>; <xref ref-type="bibr" rid="B34">Santiso-Mere et al., 1993</xref>). In contrast, intestinal VDR gene expression was not affected by 25(OH)D<sub>3</sub> or 1,25(OH)<sub>2</sub>D<sub>3</sub> in human cells (<xref ref-type="bibr" rid="B4">Balesaria et al., 2009</xref>). Similarly, we also found that vitamin D<sub>3</sub> metabolites did not have an effect on the regulation of VDR gene expression in broiler chickens. How vitamin D<sub>3</sub> metabolites differently regulate intestinal calcium homeostasis-associated gene expression in broiler chickens remains to be investigated in the further studies.</p>
		</sec>
		<sec sec-type="conclusions">
			<title>Conclusions</title>
			<p>Calbindin, β-glucuronidase, TRPV6, and NaPi-IIb cotransporter gene expression is rapidly responsive to dietary vitamin D<sub>3</sub> metabolites in the duodenum of broilers. Among vitamin D metabolites, 1,25(OH)<sub>2</sub>D<sub>3</sub> is the most effective at regulating calcium homeostasis-associated genes in broilers.</p>
		</sec>
	</body>
	<back>
		<ack>
			<title>Acknowledgments</title>
			<p>This work was supported by the Ministry of Science and Technology (NSC 99-2324-B-197-007) of Taiwan. The first and second authors contributed equally to this work.</p>
		</ack>
		<ref-list>
			<title>References</title>
			<ref id="B1">
				<element-citation publication-type="book">
					<person-group person-group-type="author">
						<collab>AOAC - Association of Official Analytical Chemists</collab>
					</person-group>
					<year>1995a</year>
					<source>Calcium analysis 968.08. Official methods of analysis</source>
					<publisher-name>AOAC</publisher-name>
					<publisher-loc>Gaithersburg, MD</publisher-loc>
				</element-citation>
				<mixed-citation>AOAC - Association of Official Analytical Chemists. 1995a. Calcium analysis 968.08. Official methods of analysis. AOAC, Gaithersburg, MD.</mixed-citation>
			</ref>
			<ref id="B2">
				<element-citation publication-type="book">
					<person-group person-group-type="author">
						<collab>AOAC - Association of Official Analytical Chemists</collab>
					</person-group>
					<year>1995b</year>
					<source>Phosphorus analysis 964.06. Official methods of analysis</source>
					<publisher-name>AOAC</publisher-name>
					<publisher-loc>Gaithersburg, MD</publisher-loc>
				</element-citation>
				<mixed-citation>AOAC - Association of Official Analytical Chemists. 1995b. Phosphorus analysis 964.06. Official methods of analysis. AOAC, Gaithersburg, MD.</mixed-citation>
			</ref>
			<ref id="B3">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Armbrecht</surname>
							<given-names>H. J.</given-names>
						</name>
						<name>
							<surname>Chen</surname>
							<given-names>M. L.</given-names>
						</name>
						<name>
							<surname>Hodam</surname>
							<given-names>T. L.</given-names>
						</name>
						<name>
							<surname>Boltz</surname>
							<given-names>M. A.</given-names>
						</name>
					</person-group>
					<year>1997</year>
					<article-title>Induction of 24-hydroxylase cytochrome P450 mRNA by 1,25-dihydroxyvitamin D and phorbol esters in normal rat kidney (NRK-52E) cells</article-title>
					<source>Journal of Endocrinology</source>
					<volume>153</volume>
					<fpage>199</fpage>
					<lpage>205</lpage>
				</element-citation>
				<mixed-citation>Armbrecht, H. J.; Chen, M. L.; Hodam, T. L. and Boltz, M. A. 1997 Induction of 24-hydroxylase cytochrome P450 mRNA by 1,25-dihydroxyvitamin D and phorbol esters in normal rat kidney (NRK-52E) cells. Journal of Endocrinology 153:199-205.</mixed-citation>
			</ref>
			<ref id="B4">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Balesaria</surname>
							<given-names>S.</given-names>
						</name>
						<name>
							<surname>Sangha</surname>
							<given-names>S.</given-names>
						</name>
						<name>
							<surname>Walters</surname>
							<given-names>J. R.</given-names>
						</name>
					</person-group>
					<year>2009</year>
					<article-title>Human duodenum responses to vitamin D metabolites of TRPV6 and other genes involved in calcium absorption</article-title>
					<source>American Journal of Physiology-Gastrointestinal and Liver Physiology</source>
					<volume>297</volume>
					<fpage>G1193</fpage>
					<lpage>G1197</lpage>
				</element-citation>
				<mixed-citation>Balesaria, S.; Sangha, S. and Walters, J. R. 2009. Human duodenum responses to vitamin D metabolites of TRPV6 and other genes involved in calcium absorption. American Journal of Physiology-Gastrointestinal and Liver Physiology 297:G1193-1197.</mixed-citation>
			</ref>
			<ref id="B5">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Baker</surname>
							<given-names>D. H.</given-names>
						</name>
						<name>
							<surname>Biehl</surname>
							<given-names>R. R.</given-names>
						</name>
						<name>
							<surname>Emmert</surname>
							<given-names>J. L.</given-names>
						</name>
					</person-group>
					<year>1998</year>
					<article-title>Vitamin D3 requirement of young chicks receiving diets varying in calcium and available phosphorus</article-title>
					<source>British Poultry Science</source>
					<volume>39</volume>
					<fpage>413</fpage>
					<lpage>417</lpage>
				</element-citation>
				<mixed-citation>Baker, D. H.; Biehl, R. R. and Emmert, J. L. 1998. Vitamin D3 requirement of young chicks receiving diets varying in calcium and available phosphorus. British Poultry Science 39:413-417.</mixed-citation>
			</ref>
			<ref id="B6">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Bolt</surname>
							<given-names>M. J.</given-names>
						</name>
						<name>
							<surname>Cao</surname>
							<given-names>L. P.</given-names>
						</name>
						<name>
							<surname>Kong</surname>
							<given-names>J.</given-names>
						</name>
						<name>
							<surname>Sitrin</surname>
							<given-names>M. D.</given-names>
						</name>
						<name>
							<surname>Li</surname>
							<given-names>Y. C.</given-names>
						</name>
					</person-group>
					<year>2005</year>
					<article-title>Vitamin D receptor is required for dietary calcium-induced repression of calbindin-D9k expression in mice</article-title>
					<source>Journal of Nutritional Biochemistry</source>
					<volume>16</volume>
					<fpage>286</fpage>
					<lpage>290</lpage>
				</element-citation>
				<mixed-citation>Bolt, M. J.; Cao, L. P.; Kong, J.; Sitrin, M. D. and Li, Y. C. 2005. Vitamin D receptor is required for dietary calcium-induced repression of calbindin-D9k expression in mice. Journal of Nutritional Biochemistry 16:286-290.</mixed-citation>
			</ref>
			<ref id="B7">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Brehier</surname>
							<given-names>A.</given-names>
						</name>
						<name>
							<surname>Thomasset</surname>
							<given-names>M.</given-names>
						</name>
					</person-group>
					<year>1990</year>
					<article-title>Stimulation of calbindin-D9k (CaBP9K) gene expression by calcium and 1,25-dihydroxycholecalciferol in fetal rat duodenal organ culture</article-title>
					<source>Endocrinology</source>
					<volume>127</volume>
					<fpage>580</fpage>
					<lpage>587</lpage>
				</element-citation>
				<mixed-citation>Brehier, A. and Thomasset, M. 1990. Stimulation of calbindin-D9k (CaBP9K) gene expression by calcium and 1,25-dihydroxycholecalciferol in fetal rat duodenal organ culture. Endocrinology 127:580-587.</mixed-citation>
			</ref>
			<ref id="B8">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Chou</surname>
							<given-names>S. H.</given-names>
						</name>
						<name>
							<surname>Chung</surname>
							<given-names>T. K.</given-names>
						</name>
						<name>
							<surname>Yu</surname>
							<given-names>B.</given-names>
						</name>
					</person-group>
					<year>2009</year>
					<article-title>Effects of supplemental 25-hydroxycholecalciferol on growth performance, small intestinal morphology, and immune response of broiler chickens</article-title>
					<source>Poultry Science</source>
					<volume>88</volume>
					<fpage>2333</fpage>
					<lpage>2341</lpage>
				</element-citation>
				<mixed-citation>Chou, S. H.; Chung, T. K. and Yu, B. 2009. Effects of supplemental 25-hydroxycholecalciferol on growth performance, small intestinal morphology, and immune response of broiler chickens. Poultry Science 88:2333-2341.</mixed-citation>
			</ref>
			<ref id="B9">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Costa</surname>
							<given-names>E. M.</given-names>
						</name>
						<name>
							<surname>Hirst</surname>
							<given-names>M. A.</given-names>
						</name>
						<name>
							<surname>Feldman</surname>
							<given-names>D.</given-names>
						</name>
					</person-group>
					<year>1985</year>
					<article-title>Regulation of 1,25-dihydroxyvitamin D3 receptors by vitamin D analogs in cultured mammalian cells</article-title>
					<source>Endocrinology</source>
					<volume>117</volume>
					<fpage>2203</fpage>
					<lpage>2210</lpage>
				</element-citation>
				<mixed-citation>Costa, E. M.; Hirst, M. A. and Feldman, D. 1985. Regulation of 1,25-dihydroxyvitamin D3 receptors by vitamin D analogs in cultured mammalian cells. Endocrinology 117:2203-2210.</mixed-citation>
			</ref>
			<ref id="B10">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Edwards</surname>
							<given-names>H. M.</given-names>
							<suffix>Jr.</suffix>
						</name>
					</person-group>
					<year>1990</year>
					<article-title>Efficacy of several vitamin D compounds in the prevention of tibial dyschondroplasia in broiler chickens</article-title>
					<source>Journal of Nutrition</source>
					<volume>120</volume>
					<fpage>1054</fpage>
					<lpage>1061</lpage>
				</element-citation>
				<mixed-citation>Edwards, H. M. Jr. 1990. Efficacy of several vitamin D compounds in the prevention of tibial dyschondroplasia in broiler chickens. Journal of Nutrition 120:1054-1061.</mixed-citation>
			</ref>
			<ref id="B11">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Ferrari</surname>
							<given-names>S.</given-names>
						</name>
						<name>
							<surname>Molinari</surname>
							<given-names>S.</given-names>
						</name>
						<name>
							<surname>Battini</surname>
							<given-names>R.</given-names>
						</name>
						<name>
							<surname>Cossu</surname>
							<given-names>G.</given-names>
						</name>
						<name>
							<surname>Lamon-Fava</surname>
							<given-names>S.</given-names>
						</name>
					</person-group>
					<year>1992</year>
					<article-title>Induction of calbindin-D28k by 1,25-dihydroxyvitamin D3 in cultured chicken intestinal cells</article-title>
					<source>Experimental Cell Research</source>
					<volume>200</volume>
					<fpage>528</fpage>
					<lpage>531</lpage>
				</element-citation>
				<mixed-citation>Ferrari, S.; Molinari, S.; Battini, R.; Cossu, G. and Lamon-Fava, S. 1992. Induction of calbindin-D28k by 1,25-dihydroxyvitamin D3 in cultured chicken intestinal cells. Experimental Cell Research 200:528-531.</mixed-citation>
			</ref>
			<ref id="B12">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Fleming</surname>
							<given-names>R. H.</given-names>
						</name>
					</person-group>
					<year>2008</year>
					<article-title>Nutritional factors affecting poultry bone health</article-title>
					<source>Proceedings of the Nutrition Society</source>
					<volume>67</volume>
					<fpage>177</fpage>
					<lpage>183</lpage>
				</element-citation>
				<mixed-citation>Fleming, R. H. 2008. Nutritional factors affecting poultry bone health. Proceedings of the Nutrition Society 67:177-183.</mixed-citation>
			</ref>
			<ref id="B13">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Fritts</surname>
							<given-names>C. A.</given-names>
						</name>
						<name>
							<surname>Waldroup</surname>
							<given-names>P. W.</given-names>
						</name>
					</person-group>
					<year>2003</year>
					<article-title>Effect of source and level of vitamin D on live performance and bone development in growing broilers</article-title>
					<source>Journal of Applied Poultry Research</source>
					<volume>12</volume>
					<fpage>45</fpage>
					<lpage>52</lpage>
				</element-citation>
				<mixed-citation>Fritts, C. A. and Waldroup, P. W. 2003. Effect of source and level of vitamin D on live performance and bone development in growing broilers. Journal of Applied Poultry Research 12:45-52.</mixed-citation>
			</ref>
			<ref id="B14">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Hall</surname>
							<given-names>A. K.</given-names>
						</name>
						<name>
							<surname>Norman</surname>
							<given-names>A. W.</given-names>
						</name>
					</person-group>
					<year>1990</year>
					<article-title>Regulation of calbindin-D28K gene expression in the chick intestine: effects of serum calcium status and 1,25-dihydroxyvitamin D</article-title>
					<source>Journal of Bone and Mineral Research</source>
					<volume>5</volume>
					<fpage>331</fpage>
					<lpage>336</lpage>
				</element-citation>
				<mixed-citation>Hall, A. K. and Norman, A. W. 1990. Regulation of calbindin-D28K gene expression in the chick intestine: effects of serum calcium status and 1,25-dihydroxyvitamin D. Journal of Bone and Mineral Research 5:331-336.</mixed-citation>
			</ref>
			<ref id="B15">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Han</surname>
							<given-names>J. C.</given-names>
						</name>
						<name>
							<surname>Wang</surname>
							<given-names>J. G.</given-names>
						</name>
						<name>
							<surname>Chen</surname>
							<given-names>G. H.</given-names>
						</name>
						<name>
							<surname>Qu</surname>
							<given-names>H. X.</given-names>
						</name>
						<name>
							<surname>Zhang</surname>
							<given-names>J. L.</given-names>
						</name>
						<name>
							<surname>Shi</surname>
							<given-names>C. X.</given-names>
						</name>
						<name>
							<surname>Yan</surname>
							<given-names>Y. F.</given-names>
						</name>
						<name>
							<surname>Cheng</surname>
							<given-names>Y. H.</given-names>
						</name>
					</person-group>
					<year>2016</year>
					<article-title>Effects of calcium to non-phytate phosphorus ratio and different sources of vitamin D on growth performance and bone mineralization in broiler chickens</article-title>
					<source>Revista Brasileira de Zootecnia</source>
					<volume>45</volume>
					<fpage>1</fpage>
					<lpage>7</lpage>
				</element-citation>
				<mixed-citation>Han, J. C.; Wang, J. G.; Chen, G. H.; Qu, H. X.; Zhang, J. L.; Shi, C. X.; Yan, Y. F. and Cheng, Y. H. 2016. Effects of calcium to non-phytate phosphorus ratio and different sources of vitamin D on growth performance and bone mineralization in broiler chickens. Revista Brasileira de Zootecnia 45:1-7.</mixed-citation>
			</ref>
			<ref id="B16">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Han</surname>
							<given-names>J. C.</given-names>
						</name>
						<name>
							<surname>Yang</surname>
							<given-names>X. D.</given-names>
						</name>
						<name>
							<surname>Zhang</surname>
							<given-names>T.</given-names>
						</name>
						<name>
							<surname>Li</surname>
							<given-names>H.</given-names>
						</name>
						<name>
							<surname>Li</surname>
							<given-names>W. L.</given-names>
						</name>
						<name>
							<surname>Zhang</surname>
							<given-names>Z. Y.</given-names>
						</name>
						<name>
							<surname>Yao</surname>
							<given-names>J. H.</given-names>
						</name>
					</person-group>
					<year>2009</year>
					<article-title>Effects of 1α-hydroxycholecalciferol on growth performance, parameters of tibia and plasma, meat quality, and type IIb sodium phosphate cotransporter gene expression of one- to twenty-one-day-old broilers</article-title>
					<source>Poultry Science</source>
					<volume>88</volume>
					<fpage>323</fpage>
					<lpage>329</lpage>
				</element-citation>
				<mixed-citation>Han, J. C.; Yang, X. D.; Zhang, T.; Li, H.; Li, W. L.; Zhang, Z. Y. and Yao, J. H. 2009. Effects of 1α-hydroxycholecalciferol on growth performance, parameters of tibia and plasma, meat quality, and type IIb sodium phosphate cotransporter gene expression of one- to twenty-one-day-old broilers. Poultry Science 88:323-329.</mixed-citation>
			</ref>
			<ref id="B17">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Haussler</surname>
							<given-names>M. R.</given-names>
						</name>
						<name>
							<surname>Whitfield</surname>
							<given-names>G. K.</given-names>
						</name>
						<name>
							<surname>Haussler</surname>
							<given-names>C. A.</given-names>
						</name>
						<name>
							<surname>Hsieh</surname>
							<given-names>J. C.</given-names>
						</name>
						<name>
							<surname>Thompson</surname>
							<given-names>P. D.</given-names>
						</name>
						<name>
							<surname>Selznick</surname>
							<given-names>S. H.</given-names>
						</name>
						<name>
							<surname>Dominguez</surname>
							<given-names>C. E.</given-names>
						</name>
						<name>
							<surname>Jurutka</surname>
							<given-names>P. W.</given-names>
						</name>
					</person-group>
					<year>1998</year>
					<article-title>The nuclear vitamin D receptor: biological and molecular regulatory properties revealed</article-title>
					<source>Journal of Bone and Mineral Research</source>
					<volume>13</volume>
					<fpage>325</fpage>
					<lpage>349</lpage>
				</element-citation>
				<mixed-citation>Haussler, M. R.; Whitfield, G. K.; Haussler, C. A.; Hsieh, J. C.; Thompson, P. D.; Selznick, S. H.; Dominguez, C. E. and Jurutka, P. W. 1998. The nuclear vitamin D receptor: biological and molecular regulatory properties revealed. Journal of Bone and Mineral Research 13:325-349.</mixed-citation>
			</ref>
			<ref id="B18">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Henry</surname>
							<given-names>H. L.</given-names>
						</name>
					</person-group>
					<year>1979</year>
					<article-title>Regulation of the hydroxylation of 25-hydroxyvitamin D3 in vivo and in primary cultures of chick kidney cells</article-title>
					<source>Journal of Biological Chemistry</source>
					<volume>254</volume>
					<fpage>2722</fpage>
					<lpage>2729</lpage>
				</element-citation>
				<mixed-citation>Henry, H. L. 1979. Regulation of the hydroxylation of 25-hydroxyvitamin D3 in vivo and in primary cultures of chick kidney cells. Journal of Biological Chemistry 254:2722-2729.</mixed-citation>
			</ref>
			<ref id="B19">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Henry</surname>
							<given-names>H. L.</given-names>
						</name>
					</person-group>
					<year>1985</year>
					<article-title>Parathyroid hormone modulation of 25-hydroxyvitamin D3 metabolism by cultured chick kidney cells is mimicked and enhanced by forskolin</article-title>
					<source>Endocrinology</source>
					<volume>116</volume>
					<fpage>503</fpage>
					<lpage>510</lpage>
				</element-citation>
				<mixed-citation>Henry, H. L. 1985. Parathyroid hormone modulation of 25-hydroxyvitamin D3 metabolism by cultured chick kidney cells is mimicked and enhanced by forskolin. Endocrinology 116:503-510.</mixed-citation>
			</ref>
			<ref id="B20">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Hilfiker</surname>
							<given-names>H.</given-names>
						</name>
						<name>
							<surname>Hattenhauer</surname>
							<given-names>O.</given-names>
						</name>
						<name>
							<surname>Traebert</surname>
							<given-names>M.</given-names>
						</name>
						<name>
							<surname>Forster</surname>
							<given-names>I.</given-names>
						</name>
						<name>
							<surname>Murer</surname>
							<given-names>H.</given-names>
						</name>
						<name>
							<surname>Biber</surname>
							<given-names>J.</given-names>
						</name>
					</person-group>
					<year>1998</year>
					<article-title>Characterization of a murine type II sodiumphosphate cotransporter expressed in mammalian intestine</article-title>
					<source>Proceedings of the National Academy of Sciences</source>
					<volume>95</volume>
					<fpage>14564</fpage>
					<lpage>14569</lpage>
				</element-citation>
				<mixed-citation>Hilfiker, H.; Hattenhauer, O.; Traebert, M.; Forster, I.; Murer, H. and Biber, J. 1998. Characterization of a murine type II sodiumphosphate cotransporter expressed in mammalian intestine. Proceedings of the National Academy of Sciences 95:14564-14569.</mixed-citation>
			</ref>
			<ref id="B21">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Hoenderop</surname>
							<given-names>J. G.</given-names>
						</name>
						<name>
							<surname>van der Kemp</surname>
							<given-names>A. W.</given-names>
						</name>
						<name>
							<surname>Urben</surname>
							<given-names>C. M.</given-names>
						</name>
						<name>
							<surname>Strugnell</surname>
							<given-names>S. A.</given-names>
						</name>
						<name>
							<surname>Bindels</surname>
							<given-names>R. J.</given-names>
						</name>
					</person-group>
					<year>2004</year>
					<article-title>Effects of vitamin D compounds on renal and intestinal Ca2+ transport proteins in 25-hydroxyvitamin D3-1alpha-hydroxylase knockout mice</article-title>
					<source>Kidney International</source>
					<volume>66</volume>
					<fpage>1082</fpage>
					<lpage>1089</lpage>
				</element-citation>
				<mixed-citation>Hoenderop, J. G.; van der Kemp, A. W.; Urben, C. M.; Strugnell, S. A. and Bindels, R. J. 2004. Effects of vitamin D compounds on renal and intestinal Ca2+ transport proteins in 25-hydroxyvitamin D3-1alpha-hydroxylase knockout mice. Kidney International 66:1082-1089.</mixed-citation>
			</ref>
			<ref id="B22">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Katai</surname>
							<given-names>K.</given-names>
						</name>
						<name>
							<surname>Miyamoto</surname>
							<given-names>K.</given-names>
						</name>
						<name>
							<surname>Kishida</surname>
							<given-names>S.</given-names>
						</name>
						<name>
							<surname>Segawa</surname>
							<given-names>H.</given-names>
						</name>
						<name>
							<surname>Nii</surname>
							<given-names>T.</given-names>
						</name>
						<name>
							<surname>Tanaka</surname>
							<given-names>H.</given-names>
						</name>
						<name>
							<surname>Tani</surname>
							<given-names>Y.</given-names>
						</name>
						<name>
							<surname>Arai</surname>
							<given-names>H.</given-names>
						</name>
						<name>
							<surname>Tatsumi</surname>
							<given-names>S.</given-names>
						</name>
						<name>
							<surname>Morita</surname>
							<given-names>K.</given-names>
						</name>
						<name>
							<surname>Taketani</surname>
							<given-names>Y.</given-names>
						</name>
						<name>
							<surname>Takeda.</surname>
							<given-names>E.</given-names>
						</name>
					</person-group>
					<year>1999</year>
					<article-title>Regulation of intestinal Na-dependent phosphate cotransporters by a low-phosphate diet and 1,25-dihydroxyvitamin D3</article-title>
					<source>Biochemical Journal</source>
					<volume>343</volume>
					<fpage>705</fpage>
					<lpage>712</lpage>
				</element-citation>
				<mixed-citation>Katai, K.; Miyamoto, K.; Kishida, S.; Segawa, H.; Nii, T.; Tanaka, H.; Tani, Y.; Arai, H.; Tatsumi, S.; Morita, K.; Taketani, Y. and Takeda. E. 1999. Regulation of intestinal Na-dependent phosphate cotransporters by a low-phosphate diet and 1,25-dihydroxyvitamin D3. Biochemical Journal 343:705-712.</mixed-citation>
			</ref>
			<ref id="B23">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Khanal</surname>
							<given-names>R. C.</given-names>
						</name>
						<name>
							<surname>Peters</surname>
							<given-names>T. M.</given-names>
						</name>
						<name>
							<surname>Smith</surname>
							<given-names>N. M.</given-names>
						</name>
						<name>
							<surname>Nemere</surname>
							<given-names>I.</given-names>
						</name>
					</person-group>
					<year>2008</year>
					<article-title>Membrane receptor-initiated signaling in 1,25(OH)2D3-stimulated calcium uptake in intestinal epithelial cells</article-title>
					<source>Journal of Cellular Biochemistry</source>
					<volume>105</volume>
					<fpage>1109</fpage>
					<lpage>1116</lpage>
				</element-citation>
				<mixed-citation>Khanal, R. C.; Peters, T. M.; Smith, N. M. and Nemere, I. 2008. Membrane receptor-initiated signaling in 1,25(OH)2D3-stimulated calcium uptake in intestinal epithelial cells. Journal of Cellular Biochemistry 105:1109-1116.</mixed-citation>
			</ref>
			<ref id="B24">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Koreleski</surname>
							<given-names>J.</given-names>
						</name>
						<name>
							<surname>Swiatkiewicz</surname>
							<given-names>S.</given-names>
						</name>
					</person-group>
					<year>2005</year>
					<article-title>Efficacy of different limestone particle size and 25-hydroxycholecalciferol in broiler diets</article-title>
					<source>Journal of Animal and Feed Sciences</source>
					<volume>14</volume>
					<fpage>705</fpage>
					<lpage>714</lpage>
				</element-citation>
				<mixed-citation>Koreleski, J. and Swiatkiewicz, S. 2005. Efficacy of different limestone particle size and 25-hydroxycholecalciferol in broiler diets. Journal of Animal and Feed Sciences 14:705-714.</mixed-citation>
			</ref>
			<ref id="B25">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Kumar</surname>
							<given-names>R.</given-names>
						</name>
					</person-group>
					<year>1990</year>
					<article-title>Vitamin D metabolism and mechanisms of calcium transport</article-title>
					<source>Journal of the American Society of Nephrology</source>
					<volume>1</volume>
					<fpage>30</fpage>
					<lpage>42</lpage>
				</element-citation>
				<mixed-citation>Kumar, R. 1990. Vitamin D metabolism and mechanisms of calcium transport. Journal of the American Society of Nephrology 1:30-42.</mixed-citation>
			</ref>
			<ref id="B26">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Leach</surname>
							<given-names>R. M.</given-names>
						</name>
						<name>
							<surname>Lilburn</surname>
							<given-names>M. S.</given-names>
						</name>
					</person-group>
					<year>1992</year>
					<article-title>Current knowledge on the etiology of tibial dyschondroplasia in the avian species</article-title>
					<source>Poultry Science Reviews</source>
					<volume>4</volume>
					<fpage>57</fpage>
					<lpage>65</lpage>
				</element-citation>
				<mixed-citation>Leach, R. M. and Lilburn, M. S. 1992. Current knowledge on the etiology of tibial dyschondroplasia in the avian species. Poultry Science Reviews 4:57-65.</mixed-citation>
			</ref>
			<ref id="B27">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Leach</surname>
							<given-names>R. M.</given-names>
							<suffix>Jr.</suffix>
						</name>
						<name>
							<surname>Nesheim</surname>
							<given-names>M. C.</given-names>
						</name>
					</person-group>
					<year>1965</year>
					<article-title>Nutritional genetic and morphological studies of an abnormal cartilage formation in young chicks</article-title>
					<source>Journal of Nutrition</source>
					<volume>86</volume>
					<fpage>236</fpage>
					<lpage>244</lpage>
				</element-citation>
				<mixed-citation>Leach, R. M. Jr. and Nesheim, M. C. 1965. Nutritional genetic and morphological studies of an abnormal cartilage formation in young chicks. Journal of Nutrition 86:236-244.</mixed-citation>
			</ref>
			<ref id="B28">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Meyer</surname>
							<given-names>M. B.</given-names>
						</name>
						<name>
							<surname>Watanuki</surname>
							<given-names>M.</given-names>
						</name>
						<name>
							<surname>Kim</surname>
							<given-names>S.</given-names>
						</name>
						<name>
							<surname>Shevde</surname>
							<given-names>N. K.</given-names>
						</name>
						<name>
							<surname>Pike</surname>
							<given-names>J. W.</given-names>
						</name>
					</person-group>
					<year>2006</year>
					<article-title>The human TRPV6 distal promoter contains multiple vitamin D receptor binding sites that mediate activation by 1,25-dihydroxyvitamin D3 in intestinal cells</article-title>
					<source>Molecular Endocrinology</source>
					<volume>20</volume>
					<fpage>1447</fpage>
					<lpage>1461</lpage>
				</element-citation>
				<mixed-citation>Meyer, M. B.; Watanuki, M.; Kim, S.; Shevde, N. K. and Pike, J. W. 2006. The human TRPV6 distal promoter contains multiple vitamin D receptor binding sites that mediate activation by 1,25-dihydroxyvitamin D3 in intestinal cells. Molecular Endocrinology 20:1447-1461.</mixed-citation>
			</ref>
			<ref id="B29">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Minghetti</surname>
							<given-names>P. P.</given-names>
						</name>
						<name>
							<surname>Norman</surname>
							<given-names>A. W.</given-names>
						</name>
					</person-group>
					<year>1988</year>
					<article-title>1,25(OH)2-vitamin D3 receptors: gene regulation and genetic circuitry</article-title>
					<source>FASEB Journal</source>
					<volume>2</volume>
					<fpage>3043</fpage>
					<lpage>3053</lpage>
				</element-citation>
				<mixed-citation>Minghetti, P. P. and Norman, A. W. 1988. 1,25(OH)2-vitamin D3 receptors: gene regulation and genetic circuitry. FASEB Journal 2:3043-3053.</mixed-citation>
			</ref>
			<ref id="B30">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Norman</surname>
							<given-names>A. W.</given-names>
						</name>
						<name>
							<surname>Putkey</surname>
							<given-names>J. A.</given-names>
						</name>
						<name>
							<surname>Nemere</surname>
							<given-names>I.</given-names>
						</name>
					</person-group>
					<year>1982</year>
					<article-title>Intestinal calcium transport: pleiotropic effects mediated by vitamin D</article-title>
					<source>Federation Proceedings</source>
					<volume>41</volume>
					<fpage>78</fpage>
					<lpage>83</lpage>
				</element-citation>
				<mixed-citation>Norman, A. W.; Putkey, J. A. and Nemere, I. 1982. Intestinal calcium transport: pleiotropic effects mediated by vitamin D. Federation Proceedings 41:78-83.</mixed-citation>
			</ref>
			<ref id="B31">
				<element-citation publication-type="book">
					<person-group person-group-type="author">
						<collab>NRC - National Research Council</collab>
					</person-group>
					<year>1994</year>
					<source>Nutritional requirements of poultry</source>
					<edition>9th ed.</edition>
					<publisher-name>National Academy Press</publisher-name>
					<publisher-loc>Washington, DC</publisher-loc>
				</element-citation>
				<mixed-citation>NRC - National Research Council. 1994. Nutritional requirements of poultry. 9th ed. National Academy Press, Washington, DC.</mixed-citation>
			</ref>
			<ref id="B32">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Pines</surname>
							<given-names>M.</given-names>
						</name>
						<name>
							<surname>Hasdai</surname>
							<given-names>A.</given-names>
						</name>
						<name>
							<surname>Monsonego-Ornan.</surname>
							<given-names>E.</given-names>
						</name>
					</person-group>
					<year>2005</year>
					<article-title>Tibial dyschondroplasia - tools, new insights and future prospects</article-title>
					<source>World's Poultry Science Journal</source>
					<volume>61</volume>
					<fpage>285</fpage>
					<lpage>297</lpage>
				</element-citation>
				<mixed-citation>Pines, M.; Hasdai, A. and Monsonego-Ornan. E. 2005. Tibial dyschondroplasia - tools, new insights and future prospects. World's Poultry Science Journal 61:285-297.</mixed-citation>
			</ref>
			<ref id="B33">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Roberson</surname>
							<given-names>K. D.</given-names>
						</name>
						<name>
							<surname>Edwards</surname>
							<given-names>H. M.</given-names>
							<suffix>Jr.</suffix>
						</name>
					</person-group>
					<year>1996</year>
					<article-title>Effect of dietary 1,25-dihydroxycholecalciferol level on broiler performance</article-title>
					<source>Poultry Science</source>
					<volume>75</volume>
					<fpage>90</fpage>
					<lpage>94</lpage>
				</element-citation>
				<mixed-citation>Roberson, K. D. and Edwards H. M. Jr. 1996. Effect of dietary 1,25-dihydroxycholecalciferol level on broiler performance. Poultry Science 75:90-94.</mixed-citation>
			</ref>
			<ref id="B34">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Santiso-Mere</surname>
							<given-names>D.</given-names>
						</name>
						<name>
							<surname>Sone</surname>
							<given-names>T.</given-names>
						</name>
						<name>
							<surname>Hilliard</surname>
							<given-names>G. M.</given-names>
							<suffix>4th</suffix>
						</name>
						<name>
							<surname>Pike</surname>
							<given-names>J. W.</given-names>
						</name>
						<name>
							<surname>McDonnell</surname>
							<given-names>D. P.</given-names>
						</name>
					</person-group>
					<year>1993</year>
					<article-title>Positive regulation of the vitamin D receptor by its cognate ligand in heterologous expression systems</article-title>
					<source>Molecular Endocrinology</source>
					<volume>7</volume>
					<fpage>833</fpage>
					<lpage>839</lpage>
				</element-citation>
				<mixed-citation>Santiso-Mere, D.; Sone, T.; Hilliard, G. M. 4th; Pike, J. W. and McDonnell, D. P. 1993. Positive regulation of the vitamin D receptor by its cognate ligand in heterologous expression systems. Molecular Endocrinology 7:833-839.</mixed-citation>
			</ref>
			<ref id="B35">
				<element-citation publication-type="book">
					<person-group person-group-type="author">
						<collab>SAS Institute, Inc.</collab>
					</person-group>
					<year>2008</year>
					<source>SAS/STAT user's guide. Version 9.2</source>
					<publisher-name>SAS Institute, Inc.</publisher-name>
					<publisher-loc>Cary, NC</publisher-loc>
				</element-citation>
				<mixed-citation>SAS Institute, Inc. 2008. SAS/STAT user's guide. Version 9.2. SAS Institute, Inc., Cary, NC.</mixed-citation>
			</ref>
			<ref id="B36">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Whitehead</surname>
							<given-names>C. C.</given-names>
						</name>
						<name>
							<surname>McCormack</surname>
							<given-names>H. A.</given-names>
						</name>
						<name>
							<surname>McTeir</surname>
							<given-names>L.</given-names>
						</name>
						<name>
							<surname>Fleming</surname>
							<given-names>R. H.</given-names>
						</name>
					</person-group>
					<year>2004</year>
					<article-title>High vitamin D3 requirements in broilers for bone quality and prevention of tibial dyschondroplasia and interactions with dietary calcium, available phosphorus and vitamin A</article-title>
					<source>British Poultry Science</source>
					<volume>45</volume>
					<fpage>425</fpage>
					<lpage>436</lpage>
				</element-citation>
				<mixed-citation>Whitehead, C. C.; McCormack, H. A.; McTeir, L. and Fleming, R. H. 2004. High vitamin D3 requirements in broilers for bone quality and prevention of tibial dyschondroplasia and interactions with dietary calcium, available phosphorus and vitamin A. British Poultry Science 45:425-436.</mixed-citation>
			</ref>
			<ref id="B37">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Waldenstedt</surname>
							<given-names>L.</given-names>
						</name>
					</person-group>
					<year>2006</year>
					<article-title>Nutritional factors of importance for optimal leg health in broilers: a review</article-title>
					<source>Animal Feed Science and Technology</source>
					<volume>126</volume>
					<fpage>291</fpage>
					<lpage>307</lpage>
				</element-citation>
				<mixed-citation>Waldenstedt, L. 2006. Nutritional factors of importance for optimal leg health in broilers: a review. Animal Feed Science and Technology 126:291-307.</mixed-citation>
			</ref>
			<ref id="B38">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Yarger</surname>
							<given-names>J. G.</given-names>
						</name>
						<name>
							<surname>Saunders</surname>
							<given-names>C. A.</given-names>
						</name>
						<name>
							<surname>McNaughton</surname>
							<given-names>J. L.</given-names>
						</name>
						<name>
							<surname>Quarles</surname>
							<given-names>C. L.</given-names>
						</name>
						<name>
							<surname>Hollis</surname>
							<given-names>B. W.</given-names>
						</name>
						<name>
							<surname>Gray</surname>
							<given-names>R. W.</given-names>
						</name>
					</person-group>
					<year>1995</year>
					<article-title>Comparison of dietary 25-hydroxycholecalciferol and cholecalciferol in broiler chickens</article-title>
					<source>Poultry Science</source>
					<volume>74</volume>
					<fpage>1159</fpage>
					<lpage>1167</lpage>
				</element-citation>
				<mixed-citation>Yarger, J. G.; Saunders, C. A.; McNaughton, J. L.; Quarles, C. L.; Hollis, B. W. and Gray, R. W. 1995. Comparison of dietary 25-hydroxycholecalciferol and cholecalciferol in broiler chickens. Poultry Science 74:1159-1167.</mixed-citation>
			</ref>
		</ref-list>
	</back>
</article>