<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.1 20151215//EN" "https://jats.nlm.nih.gov/publishing/1.1/JATS-journalpublishing1.dtd">
<article article-type="research-article" dtd-version="1.1" specific-use="sps-1.9" xml:lang="en" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink">
	<front>
		<journal-meta>
			<journal-id journal-id-type="publisher-id">rbz</journal-id>
			<journal-title-group>
				<journal-title>Revista Brasileira de Zootecnia</journal-title>
				<abbrev-journal-title abbrev-type="publisher">R. Bras. Zootec.</abbrev-journal-title>
			</journal-title-group>
			<issn pub-type="ppub">1516-3598</issn>
			<issn pub-type="epub">1806-9290</issn>
			<publisher>
				<publisher-name>Sociedade Brasileira de Zootecnia</publisher-name>
			</publisher>
		</journal-meta>
		<article-meta>
			<article-id pub-id-type="other">02608</article-id>
			<article-id pub-id-type="doi">10.37496/rbz5520250039</article-id>
			<article-categories>
				<subj-group subj-group-type="heading">
					<subject>Non-ruminants</subject>
				</subj-group>
			</article-categories>
			<title-group>
				<article-title>Effect of supplementation with selenium proteinate and sodium selenite on performance, digestibility, intestinal integrity, and expression of selenoproteins in weaned piglets</article-title>
			</title-group>
			<contrib-group>
				<contrib contrib-type="author">
					<contrib-id contrib-id-type="orcid">0000-0002-7186-0302</contrib-id>
					<name>
						<surname>Almeida</surname>
						<given-names>Jorge Luiz Santos de</given-names>
					</name>
					<role> Conceptualization</role>
					<role>Data curation</role>
					<role>Formal analysis</role>
					<role>Investigation</role>
					<role>Methodology</role>
					<role>Writing – original draft</role>
					<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
					<xref ref-type="corresp" rid="c01"><sup>*</sup></xref>
				</contrib>
				<contrib contrib-type="author">
					<contrib-id contrib-id-type="orcid">0000-0002-7225-5251</contrib-id>
					<name>
						<surname>Pascoal</surname>
						<given-names>Leonardo Augusto Fonseca</given-names>
					</name>
					<role>Conceptualization</role>
					<role>Funding acquisition</role>
					<role>Methodology</role>
					<role>Supervision</role>
					<role>Writing – review &amp; editing</role>
					<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
				</contrib>
				<contrib contrib-type="author">
					<contrib-id contrib-id-type="orcid">0000-0001-8226-8606</contrib-id>
					<name>
						<surname>Guerra</surname>
						<given-names>Ricardo Romão</given-names>
					</name>
					<role>Funding acquisition</role>
					<xref ref-type="aff" rid="aff3"><sup>3</sup></xref>
				</contrib>
				<contrib contrib-type="author">
					<contrib-id contrib-id-type="orcid">0000-0002-4660-3814</contrib-id>
					<name>
						<surname>Martins</surname>
						<given-names>Terezinha Domiciano Dantas</given-names>
					</name>
					<role>Supervision</role>
					<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
				</contrib>
				<contrib contrib-type="author">
					<contrib-id contrib-id-type="orcid">0000-0002-2480-1780</contrib-id>
					<name>
						<surname>Givisiez</surname>
						<given-names>Patrícia Emília Naves</given-names>
					</name>
					<role>Writing – review &amp; editing</role>
					<xref ref-type="aff" rid="aff4"><sup>4</sup></xref>
				</contrib>
				<contrib contrib-type="author">
					<contrib-id contrib-id-type="orcid">0000-0002-1010-2305</contrib-id>
					<name>
						<surname>Watanabe</surname>
						<given-names>Pedro Henrique</given-names>
					</name>
					<role>Resources</role>
					<xref ref-type="aff" rid="aff5"><sup>5</sup></xref>
				</contrib>
				<contrib contrib-type="author">
					<contrib-id contrib-id-type="orcid">0000-0003-1729-6680</contrib-id>
					<name>
						<surname>Almeida</surname>
						<given-names>Jonathan Mádson dos Santos</given-names>
					</name>
					<role>Investigation</role>
					<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
				</contrib>
				<contrib contrib-type="author">
					<contrib-id contrib-id-type="orcid">0000-0001-9759-093X</contrib-id>
					<name>
						<surname>Batista</surname>
						<given-names>João Marcos Monteiro</given-names>
					</name>
					<role>Investigation</role>
					<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
				</contrib>
				<contrib contrib-type="author">
					<contrib-id contrib-id-type="orcid">0000-0001-7645-2562</contrib-id>
					<name>
						<surname>Hermínio</surname>
						<given-names>Maria Pricila Ferreira</given-names>
					</name>
					<role>Investigation</role>
					<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
				</contrib>
				<contrib contrib-type="author">
					<contrib-id contrib-id-type="orcid">0000-0002-5851-0172</contrib-id>
					<name>
						<surname>Santos</surname>
						<given-names>Verônica Lisboa</given-names>
					</name>
					<role>Resources</role>
					<xref ref-type="aff" rid="aff6"><sup>6</sup></xref>
				</contrib>
				<contrib contrib-type="author">
					<contrib-id contrib-id-type="orcid">0000-0001-8757-1508</contrib-id>
					<name>
						<surname>Araújo</surname>
						<given-names>Wydemberg José de</given-names>
					</name>
					<role>Investigation</role>
					<xref ref-type="aff" rid="aff4"><sup>4</sup></xref>
				</contrib>
			</contrib-group>
			<aff id="aff1">
				<label>1</label>
				<institution content-type="orgname">Universidade Federal da Paraíba</institution>
				<institution content-type="orgdiv1">Programa de Pós-Graduação em Zootecnia</institution>
				<addr-line>
					<named-content content-type="city">Areia</named-content>
					<named-content content-type="state">PB</named-content>
				</addr-line>
				<country country="BR">Brasil</country>
				<institution content-type="original"> Universidade Federal da Paraíba, Programa de Pós-Graduação em Zootecnia, Areia, PB, Brasil.</institution>
			</aff>
			<aff id="aff2">
				<label>2</label>
				<institution content-type="orgname">Universidade Federal da Paraíba</institution>
				<institution content-type="orgdiv1">Departamento de Ciência Animal</institution>
				<addr-line>
					<named-content content-type="city">Bananeiras</named-content>
					<named-content content-type="state">PB</named-content>
				</addr-line>
				<country country="BR">Brasil</country>
				<institution content-type="original"> Universidade Federal da Paraíba, Departamento de Ciência Animal, Bananeiras, PB, Brasil.</institution>
			</aff>
			<aff id="aff3">
				<label>3</label>
				<institution content-type="orgname">Universidade Federal da Paraíba</institution>
				<institution content-type="orgdiv1">Departamento de Ciências Veterinárias</institution>
				<addr-line>
					<named-content content-type="city">Areia</named-content>
					<named-content content-type="state">PB</named-content>
				</addr-line>
				<country country="BR">Brasil</country>
				<institution content-type="original"> Universidade Federal da Paraíba, Departamento de Ciências Veterinárias, Areia, PB, Brasil.</institution>
			</aff>
			<aff id="aff4">
				<label>4</label>
				<institution content-type="orgname">Universidade Federal da Paraíba</institution>
				<institution content-type="orgdiv1">Departamento de Zootecnia</institution>
				<addr-line>
					<named-content content-type="city">Areia</named-content>
					<named-content content-type="state">PB</named-content>
				</addr-line>
				<country country="BR">Brasil</country>
				<institution content-type="original"> Universidade Federal da Paraíba, Departamento de Zootecnia, Areia, PB, Brasil.</institution>
			</aff>
			<aff id="aff5">
				<label>5</label>
				<institution content-type="orgname">Universidade Federal do Ceará</institution>
				<institution content-type="orgdiv1">Departamento de Zootecnia</institution>
				<addr-line>
					<named-content content-type="city">Fortaleza</named-content>
					<named-content content-type="state">CE</named-content>
				</addr-line>
				<country country="BR">Brasil</country>
				<institution content-type="original"> Universidade Federal do Ceará, Departamento de Zootecnia, Fortaleza, CE, Brasil.</institution>
			</aff>
			<aff id="aff6">
				<label>6</label>
				<institution content-type="orgname">YesSinergy Agroindustrial</institution>
				<addr-line>
					<named-content content-type="city">Lucélia</named-content>
					<named-content content-type="state">SP</named-content>
				</addr-line>
				<country country="BR">Brasil</country>
				<institution content-type="original"> YesSinergy Agroindustrial, Lucélia, SP, Brasil.</institution>
			</aff>
			<author-notes>
				<corresp id="c01">
					<label>*Corresponding author:</label>
					<email>luizjorgealmeida@gmail.com</email>
				</corresp>
				<fn fn-type="edited-by">
					<label>Editors:</label>
					<p>Ines Andretta</p>
					<p>Cesar Augusto Pospissil Garbossa</p>
				</fn>
				<fn fn-type="coi-statement">
					<label>Conflict of interest:</label>
					<p> The authors declare no conflict of interest.</p>
				</fn>
			</author-notes>
			<pub-date date-type="pub" publication-format="electronic">
				<day>08</day>
				<month>07</month>
				<year>2026</year>
			</pub-date>
			<pub-date date-type="collection" publication-format="electronic">
				<year>2026</year>
			</pub-date>
			<volume>55</volume>
			<elocation-id>e20250039</elocation-id>
			<history>
				<date date-type="received">
					<day>26</day>
					<month>02</month>
					<year>2025</year>
				</date>
				<date date-type="accepted">
					<day>19</day>
					<month>07</month>
					<year>2025</year>
				</date>
			</history>
			<permissions>
				<license license-type="open-access" xlink:href="https://creativecommons.org/licenses/by/4.0/" xml:lang="en">
					<license-p>This is an open access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
				</license>
			</permissions>
			<abstract>
				<title>ABSTRACT</title>
				<p>The study was carried out with the objective of investigating the enrichment of weaned piglet diets with selenium proteinate (SeP) and sodium selenite (SeS) at two inclusion levels. A total of 40 piglets, averaging 6.60 ± 1.06 kg, were assigned to five dietary treatments: a control diet, and diets supplemented with selenium proteinate (0.15 or 0.30 mg/kg) or sodium selenite (0.15 or 0.30 mg/kg). The SeP-0.30 diet reduced average daily feed intake (ADFI) (P&lt;0.05) in both periods and average daily gain (ADG) (P = 0.017) in the second period. Diets with selenium proteinate improved the digestibility of dry matter (DM; P = 0.024) and organic matter (OM; P = 0.024). All selenium-enriched diets increased selenium retention (P&lt;0.05). The addition of 0.30 mg/kg of selenium reduced villus height (VH) (P = 0.001), villus width (VW) (P = 0.001), crypt depth (CD) (P&lt;0.0001), and mitotic rate (P = 0.031). Sodium selenite reduced apoptosis in the jejunal epithelium (P = 0.020) and increased hepatic selenoprotein P (SePP) expression (P = 0.038). High concentrations of sodium selenite elevated hepatic selenoproteins, serum creatinine (CRC), and Immunoglobulin A (IgA) concentrations. Supplementation with sodium selenite should not exceed 0.30 mg/kg, whereas selenium proteinate is recommended at up to 0.15 mg/kg. Increasing selenium, particularly as proteinate, yields positive results, but levels above 0.30 mg/kg may be detrimental.</p>
			</abstract>
			<kwd-group xml:lang="en">
				<title>Keywords:</title>
				<kwd>antioxidant</kwd>
				<kwd>immunity</kwd>
				<kwd>oxidation process</kwd>
				<kwd>serum parameters</kwd>
			</kwd-group>
			<counts>
				<fig-count count="3"/>
				<table-count count="10"/>
				<equation-count count="3"/>
				<ref-count count="36"/>
			</counts>
		</article-meta>
	</front>
	<body>
		<sec sec-type="intro">
			<title>1. Introduction</title>
			<p>Selenium is an essential trace element for pigs. It contributes to immune function, enhances antioxidant activity, and helps prevent conditions such as muscular dystrophy, exudative diathesis, necrotic degeneration of the liver and mulberry heart pathology (Żarczyńska et al., 2013; <xref ref-type="bibr" rid="B3">Cao et al., 2014</xref>; <xref ref-type="bibr" rid="B19">Rao et al., 2023</xref>). This is particularly relevant in the post-weaning phase, when selenium requirements are higher than in subsequent phases <xref ref-type="bibr" rid="B15">NRC (2012)</xref>. In this sense, meeting the selenium requirement is necessary to avoid pathologies and maintain redox balance.</p>
			<p>Selenium has one of the narrowest margins between dietary deficiency (&lt;40 μg/day) and toxicity levels (&gt;400 μg/day) of all the elements (<xref ref-type="bibr" rid="B32">WHO, 1996</xref>), especially when supplemented through inorganic sources such as sodium selenite. The selenium requirement recommended by the <xref ref-type="bibr" rid="B15">NRC (2012)</xref> for piglets is 0.300 mg/kg, and <xref ref-type="bibr" rid="B21">Rostagno et al. (2011)</xref> recommend 0.410 mg/kg of organic source for post-weaning piglets. However, <xref ref-type="bibr" rid="B22">Rostagno et al. (2017)</xref> recommend 0.517 mg/kg of inorganic source and 0.233 mg/kg of organic source for post-weaning piglets. Therefore, studies comparing selenium sources and inclusion levels are warranted.</p>
			<p>Various organic selenium sources, such as selenium-enriched yeast, selenium proteinate, and selenium-amino acid, have been introduced to the animal feed industry. Other organic selenium sources have been developed to improve the bioavailability of Se products in animals and selenium proteinate is one of these organic Se sources which is produced using enzymatically hydrolyzed soy protein (<xref ref-type="bibr" rid="B8">Jang et al., 2010</xref>). The source and inclusion level of selenium are critical for animal nutrition, as they influence muscle selenium deposition (<xref ref-type="bibr" rid="B36">Zoidis et al., 2014</xref>; <xref ref-type="bibr" rid="B35">Zhang et al., 2020</xref>), typically show greater bioavailability for organic than inorganic sources (<xref ref-type="bibr" rid="B14">Lyons et al., 2007</xref>; <xref ref-type="bibr" rid="B19">Rao et al., 2023</xref>).</p>
			<p>Therefore, this study was conducted with the objective of investigating the enrichment of diets for weaned piglets using selenium proteinate and sodium selenite and two addition levels (0.15 and 0.30 mg/kg) on productive performance and metabolism.</p>
		</sec>
		<sec sec-type="materials|methods">
			<title>2. Material and methods</title>
			<p>The experimental test was carried out at the Pig Farming Laboratory of the Department of Animal Science at the Center for Human, Social and Agrarian Sciences at the Universidade Federal da Paraíba in Bananeiras, PB, Brazil (6°45'12.9&quot; South latitude, 35°38'57.5&quot; West longitude, and average altitude of 552 m). The experimental procedures were approved by Ethics Committee on the Use of Animals of the Universidade Federal da Paraíba (CEUA/UFPB), under experimental protocol number 4328201218.</p>
			<sec>
				<title>2.1. Animals and experimental diets</title>
				<p>A total of 40 piglets (20 castrated males and 20 females) weaned at 28 days of age, with an average initial body weight of 6.60±1.06 kg, and all from the same commercial strain (Topigs) were used. The number of animals used followed the guidelines of the CEUA/UFPB. Sample size was determined according to <xref ref-type="bibr" rid="B24">Sakomura and Rostagno (2016)</xref>. Piglets did not receive additional selenium supplementation during the pre-weaning phase.</p>
				<p>The pigs were housed in suspended nursery cages with a perforated plastic floor, equipped with nipple drinkers and semi-automatic feeders.</p>
				<p>Animals were allocated in a randomized block design with five dietary treatments and four replicates, with the experimental unit consisting of two pigs (one male and one female). The dietary treatments were as follows: control diet containing selenium from the mineral supplement (control diet); control diet enriched with selenium proteinate with 0.15 mg/kg of selenium added (SeP-0.15); control diet enriched with selenium proteinate with 0.30 mg/kg of selenium added (SeP-0.30); control diet enriched with sodium selenite with 0.15 mg/kg of selenium added (SeS-0.15); and control diet enriched with sodium selenite with 0.30 mg/kg of selenium added (SeS-0.30). The basal selenium in the control diet was derived from the mineral supplement (<xref ref-type="table" rid="t1">Table 1</xref>).</p>
				<p>
					<table-wrap id="t1">
						<label>Table 1</label>
						<caption>
							<title>Levels of selenium concentrations in the experimental diets1</title>
						</caption>
						<table frame="hsides" rules="groups">
							<colgroup>
								<col/>
								<col/>
								<col/>
								<col/>
							</colgroup>
							<thead>
								<tr>
									<th align="left" rowspan="2" style="font-weight:normal">Treatment<sup>2</sup></th>
									<th colspan="3" style="font-weight:normal">Growing phase</th>
								</tr>
								<tr>
									<th style="font-weight:normal">I (28-35 days)</th>
									<th style="font-weight:normal">II (36-45 days)</th>
									<th style="font-weight:normal">III (46-60 days)</th>
								</tr>
							</thead>
							<tbody>
								<tr>
									<td>Control diet</td>
									<td align="center">0.276</td>
									<td align="center">0.265</td>
									<td align="center">0.254</td>
								</tr>
								<tr>
									<td>SeP-0.15</td>
									<td align="center">0.426</td>
									<td align="center">0.415</td>
									<td align="center">0.404</td>
								</tr>
								<tr>
									<td>SeP-0.30</td>
									<td align="center">0.576</td>
									<td align="center">0.565</td>
									<td align="center">0.554</td>
								</tr>
								<tr>
									<td>SeS-0.15</td>
									<td align="center">0.426</td>
									<td align="center">0.415</td>
									<td align="center">0.404</td>
								</tr>
								<tr>
									<td>SeS-0.30</td>
									<td align="center">0.579</td>
									<td align="center">0.568</td>
									<td align="center">0.557</td>
								</tr>
							</tbody>
						</table>
						<table-wrap-foot>
							<fn id="TFN1">
								<p><sup>1</sup> Selenium proteinate was used (YesSinergy, São Paulo, Brazil) and sodium selenite (Dinâmica, Indaiatuba, Brazil) as sources of selenium.</p>
							</fn>
							<fn id="TFN2">
								<p><sup>2</sup> Control diet - Control diet containing selenium from mineral supplement; SeP-0.15 - Control diet enriched with selenium proteinate with 0.15 mg/kg of selenium added; SeP-0.30 - Control diet enriched with selenium proteinate with 0.30 mg/kg of selenium added; SeS-0.15 - Control diet enriched with sodium selenite with 0.15 mg/kg of selenium added; SeS-0.30 - Control diet enriched with sodium selenite with 0.30 mg/kg of selenium added.</p>
							</fn>
						</table-wrap-foot>
					</table-wrap>
				</p>
				<p>The experimental diets, except for selenium concentration, were formulated according to the recommendations of <xref ref-type="bibr" rid="B22">Rostagno et al. (2017)</xref> for three phases: I - from 28 to 35 days of age; II - from 36 to 45 days of age; III - from 46 to 60 days of age (<xref ref-type="table" rid="t2">Table 2</xref>).</p>
				<p>
					<table-wrap id="t2">
						<label>Table 2</label>
						<caption>
							<title>Ingredients and chemical composition (g/kg, as feed) of the experimental diets</title>
						</caption>
						<table frame="hsides" rules="groups">
							<colgroup>
								<col/>
								<col/>
								<col/>
								<col/>
							</colgroup>
							<thead>
								<tr>
									<th align="left" style="font-weight:normal">Ingredient</th>
									<th style="font-weight:normal">28-35 days</th>
									<th style="font-weight:normal">36-45 days</th>
									<th style="font-weight:normal">46-60 days</th>
								</tr>
							</thead>
							<tbody>
								<tr>
									<td>Corn</td>
									<td align="center">457.8</td>
									<td align="center">529.2</td>
									<td align="center">700.2</td>
								</tr>
								<tr>
									<td>Soybean meal</td>
									<td align="center">327.6</td>
									<td align="center">291.0</td>
									<td align="center">239.0</td>
								</tr>
								<tr>
									<td>Whey powder</td>
									<td align="center">120.0</td>
									<td align="center">80.0</td>
									<td align="center">0.0</td>
								</tr>
								<tr>
									<td>Soy oil</td>
									<td align="center">43.4</td>
									<td align="center">40.9</td>
									<td align="center">9.5</td>
								</tr>
								<tr>
									<td>Dicalcium phosphate</td>
									<td align="center">19.6</td>
									<td align="center">18.8</td>
									<td align="center">17.3</td>
								</tr>
								<tr>
									<td>Limestone</td>
									<td align="center">9.90</td>
									<td align="center">8.93</td>
									<td align="center">7.04</td>
								</tr>
								<tr>
									<td>L-lysine HCl</td>
									<td align="center">5.46</td>
									<td align="center">5.56</td>
									<td align="center">4.49</td>
								</tr>
								<tr>
									<td>DL-methionine</td>
									<td align="center">2.40</td>
									<td align="center">2.23</td>
									<td align="center">1.19</td>
								</tr>
								<tr>
									<td>L-threonine</td>
									<td align="center">3.06</td>
									<td align="center">2.94</td>
									<td align="center">1.72</td>
								</tr>
								<tr>
									<td>L-tryptophan</td>
									<td align="center">0.55</td>
									<td align="center">0.57</td>
									<td align="center">0.39</td>
								</tr>
								<tr>
									<td>L-arginine</td>
									<td align="center">2.30</td>
									<td align="center">2.23</td>
									<td align="center">0.00</td>
								</tr>
								<tr>
									<td>L-valine</td>
									<td align="center">1.37</td>
									<td align="center">1.31</td>
									<td align="center">0.41</td>
								</tr>
								<tr>
									<td>Vitamin supplement<sup>1</sup></td>
									<td align="center">2.00</td>
									<td align="center">2.00</td>
									<td align="center">2.00</td>
								</tr>
								<tr>
									<td>Mineral supplement<sup>2</sup></td>
									<td align="center">1.00</td>
									<td align="center">1.00</td>
									<td align="center">1.00</td>
								</tr>
								<tr>
									<td>Salt</td>
									<td align="center">2.73</td>
									<td align="center">3.48</td>
									<td align="center">4.72</td>
								</tr>
								<tr>
									<td>Inert<sup>3</sup></td>
									<td align="center">1.00</td>
									<td align="center">9.95</td>
									<td align="center">11.00</td>
								</tr>
								<tr>
									<td>Calculated values</td>
									<td> </td>
									<td> </td>
									<td> </td>
								</tr>
								<tr>
									<td>Metabolizable energy (MJ/kg)</td>
									<td align="center">14.23</td>
									<td align="center">14.12</td>
									<td align="center">13.60</td>
								</tr>
								<tr>
									<td>Crude protein</td>
									<td align="center">214.20</td>
									<td align="center">198.70</td>
									<td align="center">176.90</td>
								</tr>
								<tr>
									<td>Digestible lysine</td>
									<td align="center">14.51</td>
									<td align="center">13.46</td>
									<td align="center">10.97</td>
								</tr>
								<tr>
									<td>Digestible methionine + cystine</td>
									<td align="center">8.13</td>
									<td align="center">7.54</td>
									<td align="center">6.25</td>
								</tr>
								<tr>
									<td>Digestible threonine</td>
									<td align="center">9.72</td>
									<td align="center">9.02</td>
									<td align="center">7.13</td>
								</tr>
								<tr>
									<td>Digestible tryptophan</td>
									<td align="center">2.76</td>
									<td align="center">2.56</td>
									<td align="center">2.08</td>
								</tr>
								<tr>
									<td>Digestible arginine</td>
									<td align="center">14.51</td>
									<td align="center">13.46</td>
									<td align="center">10.19</td>
								</tr>
								<tr>
									<td>Digestible valine</td>
									<td align="center">10.01</td>
									<td align="center">9.29</td>
									<td align="center">7.60</td>
								</tr>
								<tr>
									<td>Limestone</td>
									<td align="center">10.68</td>
									<td align="center">9.73</td>
									<td align="center">7.94</td>
								</tr>
								<tr>
									<td>Available phosphorous</td>
									<td align="center">5.28</td>
									<td align="center">4.81</td>
									<td align="center">3.93</td>
								</tr>
								<tr>
									<td>Sodium</td>
									<td align="center">2.24</td>
									<td align="center">2.19</td>
									<td align="center">1.99</td>
								</tr>
								<tr>
									<td>Potassium</td>
									<td align="center">9.97</td>
									<td align="center">8.69</td>
									<td align="center">6.62</td>
								</tr>
							</tbody>
						</table>
						<table-wrap-foot>
							<fn id="TFN3">
								<p><sup>1</sup> Vitamin A, 4,000 IU; vitamin D3, 220 IU; vitamin E, 22 mg; vitamin K, 0.5 mg; vitamin B2, 3.75 mg; vitamin B12, 20 mg; calcium pantothenate, 12 mg; niacina, 20 mg; choline, 400 mg.</p>
							</fn>
							<fn id="TFN4">
								<p><sup>2</sup> Iodine, 140 μg; selenium, 300 μg; manganese, 10 mg; zinc, 100 mg; copper, 10 mg; iron, 99 mg.</p>
							</fn>
							<fn id="TFN5">
								<p><sup>3</sup> The inclusion of proteinate selenium and sodium selenite was carried out in partial replacement of the inert. In the third phase, the inert was partially replaced by Celite 545, which is the internal marker of acid insoluble ash (AIC) for carrying out the apparent digestibility.</p>
							</fn>
						</table-wrap-foot>
					</table-wrap>
				</p>
			</sec>
			<sec>
				<title>2.2. Productive performance and fecal score</title>
				<p>The pigs and feed refusals were weighed at the beginning and end of each experimental phase to calculate average daily feed intake (ADFI), average daily gain (ADG) and feed conversion (FC) of the weaned piglets. Growth performance was evaluated for the periods from 28 to 45 days of age and from 28 to 60 days of age. The fecal score was evaluated from 28 to 45 days as an indication of diarrhea incidence. Fecal scores were recorded twice daily in the morning and in the late afternoon. Stool consistency was evaluated according to visual criteria, in which: 1, normal; 2, pasty; and 3, liquid; a score of 3 was considered as diarrheal stools following the method proposed by <xref ref-type="bibr" rid="B16">Pascoal et al. (2012)</xref>.</p>
			</sec>
			<sec>
				<title>2.3. Digestibility of the diets</title>
				<p>Apparent digestibility of nutrients and energy in the diets was evaluated during the third experimental phase. To this end, 1% of CELITE 545 (Diadema, SP, Brazil) was added to the diets as an internal marker and an acid-insoluble ash (AIA) source replacing the inert source. The assay lasted 7 days, with the first three days for adaptation and the last four days for feces collection. At the end, the feces of each pig were homogenized and dried at 55 °C for 72 hours. Feed and feces samples were ground and passed through a 0.5 mm sieve, then analyzed according to the procedures described by (<xref ref-type="bibr" rid="B2">AOAC, 2006</xref>) for determining dry matter (DM), mineral matter (MM), organic matter (OM) and crude protein. Gross energy was determined using an adiabatic bomb calorimeter (6100 model, Parr Instruments Co., San Francisco, CA, USA). Selenium concentration was determined by hydride generation atomic absorption spectrometry (iCE 3500 model, HGAAS ICE 3000 Series Thermo Scientific device, Cambridge, UK) coupled to a UP 100 hydride regenerator. Analysis employed Solar software program, an air-acetylene flame and a selenium hollow cathode lamp (Photoron-Lamps-Pty-Ltd, Victoria, Australia). Measurements were performed at 196 nm, with a calibration ranging from 5 to 40 mg/L. Total tract apparent digestibility coefficients (TTADC) of nutrients and energy were calculated according to <xref ref-type="bibr" rid="B1">Adeola (2000)</xref>, as follows:</p>
				<disp-formula id="e1">
					<mml:math>
						<mml:mtext> TTADC </mml:mtext>
						<mml:mo>=</mml:mo>
						<mml:mn>1</mml:mn>
						<mml:mo>−</mml:mo>
						<mml:mfrac>
							<mml:mrow>
								<mml:mtext> AIA concentration in the diet </mml:mtext>
								<mml:mo>×</mml:mo>
								<mml:mtext> Component in the feces </mml:mtext>
							</mml:mrow>
							<mml:mrow>
								<mml:mtext> AIA concentration in the feces </mml:mtext>
								<mml:mo>×</mml:mo>
								<mml:mtext> Component in the diet </mml:mtext>
							</mml:mrow>
						</mml:mfrac>
					</mml:math>
				</disp-formula>
				<p>The retained selenium and excreted selenium were calculated as follows:</p>
				<disp-formula id="e2">
					<mml:math>
						<mml:mtable>
							<mml:mtr>
								<mml:mtd/>
								<mml:mtd>
									<mml:mtext> Se retained </mml:mtext>
									<mml:mo>=</mml:mo>
									<mml:mtext> Se in diet </mml:mtext>
									<mml:mo>−</mml:mo>
									<mml:mrow>
										<mml:mo>(</mml:mo>
										<mml:mtext> Se in feces </mml:mtext>
										<mml:mo>×</mml:mo>
										<mml:mfrac>
											<mml:mtext> AIA concentration in the diet </mml:mtext>
											<mml:mtext> AIA concentration in the feces </mml:mtext>
										</mml:mfrac>
										<mml:mo>)</mml:mo>
									</mml:mrow>
								</mml:mtd>
							</mml:mtr>
							<mml:mtr>
								<mml:mtd/>
								<mml:mtd>
									<mml:mtext> Se excreted </mml:mtext>
									<mml:mo>=</mml:mo>
									<mml:mtext> Se in the diet </mml:mtext>
									<mml:mo>−</mml:mo>
									<mml:mtext> Se retained </mml:mtext>
								</mml:mtd>
							</mml:mtr>
						</mml:mtable>
					</mml:math>
				</disp-formula>
			</sec>
			<sec>
				<title>2.4. Sampling and processing</title>
				<p>Blood samples were collected from the jugular vein of one piglet per experimental unit at 41 and 60 days of age, selected according to the average weight of each treatment. Serum was separated by centrifugation at 1006 × <italic>g</italic> for 10 minutes and transferred to microtubes (Eppendorf, São Paulo, Brazil). At the end of the experimental period, piglets were slaughtered after a 12-hour fast by electrical stunning followed by exsanguination in accordance with the procedures approved by CEUA/UFPB. Segments of the proximal duodenum portion and the mid-jejunum were collected after slaughter and immediately immersed in metacarn solution for histological and immunohistochemical evaluations. Samples were dehydrated in increasing alcohol solutions, cleared in xylene and embedded in paraffin according to the protocol described by <xref ref-type="bibr" rid="B33">Yoon et al. (2012)</xref>. Muscle samples (<italic>Longissimus thoracis</italic>) and blood were collected for selenium analysis, following the methodology used for selenium determination in diet and fecal samples. Jejunum and muscle (<italic>Longissimus thoracis</italic>) samples were collected to determine Malondialdehyde concentration, and jejunum and liver samples were collected for gene expression analysis. Samples for malondialdehyde and gene expression analysis were stored at −80 °C until further analysis.</p>
			</sec>
			<sec>
				<title>2.5. Intestinal morphometry and integrity</title>
				<p>Histological slides were stained with hematoxylin and eosin to assess intestinal morphometry. Villus height (VH), villus width (VW) and crypt depth (CD) were measured, and the villus height:crypt depth ratio (VW:CD) was calculated. Cell death by apoptosis (Caspase) and nuclear protein proliferation nuclear antigen (PCNA-rate of mitosis) were determined using the protocol used for all antibodies based on the immunohistochemistry technique (<xref ref-type="bibr" rid="B29">Terzian et al., 2007</xref>). The apoptosis rate in villous cells of the mid-jejunum was assessed by anti-neutrophil cytoplasmic antibody positivity. Positivity scores were assigned to the 20 photomicrographs per treatment using the following scale: 0 (absence of positivity), 1 (low positivity), 2 (mild positivity) and 3 (intense positivity), with methodology being adapted from (<xref ref-type="bibr" rid="B7">Ishak et al., 1995</xref>). Crypts were randomly analyzed and measured to assess the cell mitosis rate in the first duodenum portion and the middle jejunum portion, making a total of 10,000 μm of epithelium per treatment. Epithelial cells proliferation was quantified based on the number of anti-PCNA-positive nuclei. Slides were analyzed and digitized using a light microscope (Olympus BX53, 40× objective, Tokyo, Japan) coupled to a Zeiss Axio camera (Oberkochen, Germany) and a computer equipped with CellSens Dimension software (Olympus, Tokyo, Japan).</p>
			</sec>
			<sec>
				<title>2.6. Biochemical determinations</title>
				<p>Serum concentration of immunoglobulin A (IgA), immunoglobulin G (IgG), gamma glutamyl transferase (GGT), aspartate aminotransferase (AST) and creatinine (CRC) were determined spectrophotometrically using commercial kits (Labtest Diagnóstica, Lagoa Santa, Minas Gerais, Brazil): IgA (Turbiquest, ref. 358), IgG (Turbiquest, ref. 359), GGT (Liquiform, ref. 105), AST (Liquiform, ref. 109) and creatinine (CRC). Thiobarbituric acid reactive substances (TBARS) were determined according to <xref ref-type="bibr" rid="B20">Rosmini et al. (1996)</xref>. Briefly, 1.0 mL of 0.5% sulfanilamide solution, 10 mL of 10% (v/v) trichloroacetic acid (TCA) solution and 5.0 mL of distilled water were added in a tube containing 5 g of sample. The mixture was shaken for five minutes to extract malonaldehyde (MDA) and centrifuged for 5 minutes at 1006 × <italic>g</italic>. The supernatant was filtered (Whatman qualitative filter paper, Grade 1) and mixed with 5 mL of 0.02 M thiobarbituric acid (TBA). The mixture was then heated in a water bath at 100 °C for 35 min. The tubes were subsequently cooled to room temperature (25 °C) in an ice bath. Finally, the absorbance reading at 532 nm was performed in a spectrophotometer (UV-V AKSO N6000Plus, USA).</p>
			</sec>
			<sec>
				<title>2.7. Gene expression</title>
				<p>Samples from the mid-jejunum and liver were collected for gene expression analysis by quantitative real-time PCR (qPCR). Total RNA was extracted from the samples using the Qiagen RNeasy Mini kit (Cat. N.74106) and cDNA synthesis was performed using the cDNA High Capacity cDNA Reverse Transcription kit (Applied Biosystems), according to the manufacturers’ recommendations. Relative gene expression was determined by qPCR using Power SYBR Green Master Mix (Thermo Fisher Scientific, Applied Biosystems) and gene-specific primers (<xref ref-type="table" rid="t3">Table 3</xref>) for glutathione peroxidase 1 (GPX1), glutathione peroxidase 2 (GPX2), glutathione peroxidase 4 (GPX4), and selenoprotein P (SePP). The reference genes β-actin (ACTB) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were used for normalization. The qPCR cycles were performed in a thermocycler and the relative expression calculated based on the 2<sup>−Ct</sup> method (<xref ref-type="bibr" rid="B13">Livak and Schmittgen, 2001</xref>) using the reference genes for expression normalization.</p>
				<p>
					<table-wrap id="t3">
						<label>Table 3</label>
						<caption>
							<title>Genes and sequence of primers used in qPCR</title>
						</caption>
						<table frame="hsides" rules="groups">
							<colgroup>
								<col/>
								<col/>
								<col/>
								<col/>
								<col/>
							</colgroup>
							<thead>
								<tr>
									<th align="left" style="font-weight:normal">Gene</th>
									<th style="font-weight:normal">Forward Primer sequences</th>
									<th style="font-weight:normal">Reverse primers sequences</th>
									<th style="font-weight:normal">PS<sup>1</sup></th>
									<th style="font-weight:normal">Locus<sup>2</sup></th>
								</tr>
							</thead>
							<tbody>
								<tr>
									<td><italic>GPX1</italic></td>
									<td align="center">gctcggtgtatgccttctct</td>
									<td align="center">agcgacgctacgttctcaat</td>
									<td align="center">103</td>
									<td align="center">AF532927</td>
								</tr>
								<tr>
									<td><italic>GPX2</italic></td>
									<td align="center">cgtgaatggtcagaatgagc</td>
									<td align="center">gggatcagtcatgagggaaa</td>
									<td align="center">94</td>
									<td align="center">DQ898282</td>
								</tr>
								<tr>
									<td><italic>GPX4</italic></td>
									<td align="center">attctcagccaaggacatcg</td>
									<td align="center">cctcattgagaggccacatt</td>
									<td align="center">93</td>
									<td align="center">NM_214407</td>
								</tr>
								<tr>
									<td><italic>SEPP</italic></td>
									<td align="center">gctccttctgtgagcaacct</td>
									<td align="center">gcctgaagaagagcaaccac</td>
									<td align="center">97</td>
									<td align="center">EF113596</td>
								</tr>
								<tr>
									<td><italic>ACTB</italic></td>
									<td align="center">tgttcgagaccttcaacacg</td>
									<td align="center">atccccagagtccatgacaa</td>
									<td align="center">104</td>
									<td align="center">DQ845171</td>
								</tr>
								<tr>
									<td><italic>GAPDH</italic></td>
									<td align="center">acatggcctccaaggagtaaga</td>
									<td align="center">gatcgagttggggctgtgact</td>
									<td align="center">106</td>
									<td align="center">AF017079</td>
								</tr>
							</tbody>
						</table>
						<table-wrap-foot>
							<fn id="TFN6">
								<p>GPX1 - glutathione peroxidase 1; GPX2 - glutathione peroxidase 2; GPX4 - glutathione peroxidase 4; SePP - selenoprotein P; ACTB - actin beta; GAPDH - glyceraldehyde 3-phosphate dehydrogenase.</p>
							</fn>
							<fn id="TFN7">
								<p><sup>1</sup> Product size.</p>
							</fn>
							<fn id="TFN8">
								<p><sup>2</sup> GenBank.</p>
							</fn>
						</table-wrap-foot>
					</table-wrap>
				</p>
			</sec>
			<sec>
				<title>2.8. Statistical analysis</title>
				<p>A two-way analysis of variance (ANOVA) was performed to determine the effects of selenium source (SeP or SeS) and addition level (0.15 or 0.30 mg/kg) and the interaction between both factors (source × level). Differences between group means were assessed using Student’s <italic>t</italic>-test. A contrast between the control diet and the other diets was estimated by Dunnett’s test. Data were processed using the SAS statistical software (OnDemand for Academics). Effects were considered significant at P≤0.05.</p>
				<p>The proposed statistical model was as follows:</p>
				<disp-formula id="e3">
					<mml:math>
						<mml:msub>
							<mml:mi>Y</mml:mi>
							<mml:mrow>
								<mml:mi>i</mml:mi>
								<mml:mi>j</mml:mi>
								<mml:mi>k</mml:mi>
								<mml:mi>l</mml:mi>
							</mml:mrow>
						</mml:msub>
						<mml:mo>=</mml:mo>
						<mml:mi>μ</mml:mi>
						<mml:mo>+</mml:mo>
						<mml:msub>
							<mml:mi>α</mml:mi>
							<mml:mi>i</mml:mi>
						</mml:msub>
						<mml:mo>+</mml:mo>
						<mml:msub>
							<mml:mi>β</mml:mi>
							<mml:mi>j</mml:mi>
						</mml:msub>
						<mml:mo>+</mml:mo>
						<mml:mo>(</mml:mo>
						<mml:mi>α</mml:mi>
						<mml:mi>β</mml:mi>
						<mml:msub>
							<mml:mo>)</mml:mo>
							<mml:mrow>
								<mml:mi>i</mml:mi>
								<mml:mi>j</mml:mi>
							</mml:mrow>
						</mml:msub>
						<mml:mo>+</mml:mo>
						<mml:msub>
							<mml:mi>c</mml:mi>
							<mml:mi>k</mml:mi>
						</mml:msub>
						<mml:mo>+</mml:mo>
						<mml:msub>
							<mml:mi>ε</mml:mi>
							<mml:mrow>
								<mml:mi>i</mml:mi>
								<mml:mi>j</mml:mi>
								<mml:mi>k</mml:mi>
								<mml:mi>l</mml:mi>
							</mml:mrow>
						</mml:msub>
					</mml:math>
				</disp-formula>
				<p>in which <italic>Y</italic><sub><italic>ijkl</italic></sub> = value observed in the <italic>i</italic>-th selenium source, in the <italic>j</italic>-th additional level of selenium, in the <italic>k</italic>-th additional treatment and in the <italic>l</italic>-th replicate; <italic>μ</italic> = overall mean of the experiment; <italic>α</italic><sub><italic>i</italic></sub> = fixed effect of factor <italic>i</italic> (<italic>i</italic> = 1, 2); <italic>β</italic><sub><italic>j</italic></sub> = fixed effect of factor <italic>j</italic> (<italic>j</italic> = 1, 2); (<italic>αβ</italic>)<sub><italic>ij</italic></sub> = fixed effect of the interaction between factor <italic>i</italic> (<italic>i</italic> = 1, 2) and factor <italic>j</italic> (<italic>j</italic> = 1, 2); <italic>c</italic><sub><italic>k</italic></sub> = effect of contrast between the control diet and the other diets <italic>k</italic> (<italic>k</italic> = 1); and <italic>ε</italic><sub><italic>ijkl</italic></sub> = random error associated with each <italic>Y</italic><sub><italic>ijkl</italic></sub> observation.</p>
			</sec>
		</sec>
		<sec sec-type="results">
			<title>3. Results</title>
			<p>Selenium supplementation influenced feed intake and feed conversion (<xref ref-type="table" rid="t4">Table 4</xref>). There was an interaction effect (P = 0.018) between selenium source and inclusion level for the ADFI variable in both periods; pigs fed the diet containing 0.30 mg/kg of additional selenium proteinate showed lower ADFI. The addition of 0.15 mg/kg of selenium in the diets promoted higher ADFI (P = 0.006) and ADG (P = 0.017) between 28 and 60 days (P&lt;0.05), regardless of the source. Supplementation with selenium proteinate resulted in poorer FC (P = 0.052) in the period from 28 to 60 days of age when compared to sodium selenite. Fecal score was not influenced by selenium source (P = 0.692), addition level (P = 0.909) or interaction between factors (P = 0.472).</p>
			<p>
				<table-wrap id="t4">
					<label>Table 4</label>
					<caption>
						<title>Average daily feed intake (ADFI), average daily gain (ADG) and feed:gain ratio (F:G) of piglets fed diets enriched with proteinate selenium (SeP) or sodium selenite (SeS) at two addition levels (0.15 or 0.30 mg/kg)</title>
					</caption>
					<table frame="hsides" rules="groups">
						<colgroup>
							<col/>
							<col/>
							<col/>
							<col/>
							<col/>
							<col/>
							<col/>
							<col/>
						</colgroup>
						<thead>
							<tr>
								<th align="left" rowspan="2" style="font-weight:normal"> </th>
								<th colspan="3" style="font-weight:normal">28-45 days</th>
								<th align="left" rowspan="2" style="font-weight:normal"> </th>
								<th colspan="3" style="font-weight:normal">28-60 days</th>
							</tr>
							<tr>
								<th style="font-weight:normal">ADFI (kg/day)</th>
								<th style="font-weight:normal">ADG (kg/day)</th>
								<th style="font-weight:normal">F:G (kg/kg)</th>
								<th style="font-weight:normal">ADFI (kg/day)</th>
								<th style="font-weight:normal">ADG (kg/day)</th>
								<th style="font-weight:normal">F:G (kg/kg)</th>
							</tr>
						</thead>
						<tbody>
							<tr>
								<td>Dietary treatment<sup>1</sup></td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
							</tr>
							<tr>
								<td>Control diet</td>
								<td align="center">0.353</td>
								<td align="center">0.199</td>
								<td align="center">1.780</td>
								<td> </td>
								<td align="center">0.611</td>
								<td align="center">0.396</td>
								<td align="center">1.545</td>
							</tr>
							<tr>
								<td>SeP-0.15</td>
								<td align="center">0.371Aa</td>
								<td align="center">0.204</td>
								<td align="center">1.821</td>
								<td> </td>
								<td align="center">0.669Aa</td>
								<td align="center">0.424</td>
								<td align="center">1.580</td>
							</tr>
							<tr>
								<td>SeP-0.30</td>
								<td align="center">0.330Bb</td>
								<td align="center">0.186</td>
								<td align="center">1.780</td>
								<td> </td>
								<td align="center">0.562Bb</td>
								<td align="center">0.345</td>
								<td align="center">1.632</td>
							</tr>
							<tr>
								<td>SeS-0.15</td>
								<td align="center">0.349Aa</td>
								<td align="center">0.198</td>
								<td align="center">1.759</td>
								<td> </td>
								<td align="center">0.620Aa</td>
								<td align="center">0.410</td>
								<td align="center">1.512</td>
							</tr>
							<tr>
								<td>SeS-0.30</td>
								<td align="center">0.360Aa</td>
								<td align="center">0.222</td>
								<td align="center">1.625</td>
								<td> </td>
								<td align="center">0.597Aa</td>
								<td align="center">0.386</td>
								<td align="center">1.549</td>
							</tr>
							<tr>
								<td>Dietary Se source<sup>2</sup></td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
							</tr>
							<tr>
								<td>SeP</td>
								<td align="center">0.351</td>
								<td align="center">0.195</td>
								<td align="center">1.800</td>
								<td> </td>
								<td align="center">0.616</td>
								<td align="center">0.384</td>
								<td align="center">1.606A</td>
							</tr>
							<tr>
								<td>SeS</td>
								<td align="center">0.355</td>
								<td align="center">0.210</td>
								<td align="center">1.692</td>
								<td> </td>
								<td align="center">0.609</td>
								<td align="center">0.398</td>
								<td align="center">1.530B</td>
							</tr>
							<tr>
								<td>Dietary Se level<sup>2</sup></td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
							</tr>
							<tr>
								<td>0.15 (mg/kg)</td>
								<td align="center">0.360</td>
								<td align="center">0.201</td>
								<td align="center">1.790</td>
								<td> </td>
								<td align="center">0.645</td>
								<td align="center">0.417a</td>
								<td align="center">1.546</td>
							</tr>
							<tr>
								<td>0.30 (mg/kg)</td>
								<td align="center">0.345</td>
								<td align="center">0.204</td>
								<td align="center">1.702</td>
								<td> </td>
								<td align="center">0.580</td>
								<td align="center">0.365b</td>
								<td align="center">1.590</td>
							</tr>
							<tr>
								<td>ANOVA (P-value)</td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
							</tr>
							<tr>
								<td>Dietary Se source</td>
								<td align="center">0.651</td>
								<td align="center">0.337</td>
								<td align="center">0.159</td>
								<td> </td>
								<td align="center">0.719</td>
								<td align="center">0.449</td>
								<td align="center">0.052</td>
							</tr>
							<tr>
								<td>Dietary Se level</td>
								<td align="center">0.132</td>
								<td align="center">0.854</td>
								<td align="center">0.855</td>
								<td> </td>
								<td align="center">0.006</td>
								<td align="center">0.017</td>
								<td align="center">0.216</td>
							</tr>
							<tr>
								<td>Interaction</td>
								<td align="center">0.018</td>
								<td align="center">0.207</td>
								<td align="center">0.964</td>
								<td> </td>
								<td align="center">0.046</td>
								<td align="center">0.158</td>
								<td align="center">0.633</td>
							</tr>
							<tr>
								<td>Pooled SEM</td>
								<td align="center">0.007</td>
								<td align="center">0.008</td>
								<td align="center">0.051</td>
								<td> </td>
								<td align="center">0.013</td>
								<td align="center">0.017</td>
								<td align="center">0.019</td>
							</tr>
						</tbody>
					</table>
					<table-wrap-foot>
						<fn id="TFN9">
							<p>SEM - standard error of mean.</p>
						</fn>
						<fn id="TFN10">
							<p><sup>1</sup> A,B - Differentiate selenium sources at each level (SeP-0.15 X SeS0.15 and SeP-0.30 X SeS-0.30). a,b - Differentiate selenium levels in each source (SeP-0.15 X SeP-0.30 and SeS-0.15 X SeS-0.30).</p>
						</fn>
						<fn id="TFN11">
							<p><sup>2</sup> A,B - Differentiate selenium sources. a,b - Differentiate selenium levels.</p>
						</fn>
					</table-wrap-foot>
				</table-wrap>
			</p>
			<p>Selenium source influenced the apparent digestibility coefficients of DM(P = 0.024) and ash (MM; P = 0.021), with selenium proteinate promoting higher digestibility than sodium selenite. Compared with the control diet, diets supplemented with inorganic selenium at 0.15 and 0.30 mg/kg showed lower DM digestibility (P&lt;0.05; <xref ref-type="table" rid="t5">Table 5</xref>).</p>
			<p>
				<table-wrap id="t5">
					<label>Table 5</label>
					<caption>
						<title>Coefficients of apparent total tract digestibility (CATTD) of the nutrients and energy of diets enriched with proteinate selenium (SeP) or sodium selenite (SeS) at two addition levels (0.15 or 0.30 mg/kg)</title>
					</caption>
					<table frame="hsides" rules="groups">
						<colgroup>
							<col/>
							<col/>
							<col/>
							<col/>
							<col/>
						</colgroup>
						<thead>
							<tr>
								<th align="left" style="font-weight:normal"> </th>
								<th style="font-weight:normal">Dry matter</th>
								<th style="font-weight:normal">Mineral matter</th>
								<th style="font-weight:normal">Protein</th>
								<th style="font-weight:normal">Energy</th>
							</tr>
						</thead>
						<tbody>
							<tr>
								<td>Dietary treatment</td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
							</tr>
							<tr>
								<td>Control diet</td>
								<td align="center">0.939</td>
								<td align="center">0.499</td>
								<td align="center">0.781</td>
								<td align="center">0.802</td>
							</tr>
							<tr>
								<td>SeP-0.15</td>
								<td align="center">0.931</td>
								<td align="center">0.379</td>
								<td align="center">0.712</td>
								<td align="center">0.763</td>
							</tr>
							<tr>
								<td>SeP-0.30</td>
								<td align="center">0.935</td>
								<td align="center">0.409</td>
								<td align="center">0.742</td>
								<td align="center">0.784</td>
							</tr>
							<tr>
								<td>SeS-0.15</td>
								<td align="center">0.922*</td>
								<td align="center">0.543</td>
								<td align="center">0.667*</td>
								<td align="center">0.740*</td>
							</tr>
							<tr>
								<td>SeS-0.30</td>
								<td align="center">0.923*</td>
								<td align="center">0.434</td>
								<td align="center">0.731</td>
								<td align="center">0.779</td>
							</tr>
							<tr>
								<td>Dietary Se source<sup>1</sup></td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
							</tr>
							<tr>
								<td>SeP</td>
								<td align="center">0.933A</td>
								<td align="center">0.394B</td>
								<td align="center">0.727</td>
								<td align="center">0.774</td>
							</tr>
							<tr>
								<td>SeS</td>
								<td align="center">0.922B</td>
								<td align="center">0.489A</td>
								<td align="center">0.699</td>
								<td align="center">0.760</td>
							</tr>
							<tr>
								<td>Dietary Se level</td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
							</tr>
							<tr>
								<td>0.15 (mg/kg)</td>
								<td align="center">0.926</td>
								<td align="center">0.461</td>
								<td align="center">0.689</td>
								<td align="center">0.751</td>
							</tr>
							<tr>
								<td>0.30 (mg/kg)</td>
								<td align="center">0.929</td>
								<td align="center">0.422</td>
								<td align="center">0.737</td>
								<td align="center">0.782</td>
							</tr>
							<tr>
								<td>ANOVA (P-value)</td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
							</tr>
							<tr>
								<td>Dietary Se source</td>
								<td align="center">0.024</td>
								<td align="center">0.021</td>
								<td align="center">0.275</td>
								<td align="center">0.386</td>
							</tr>
							<tr>
								<td>Dietary Se level</td>
								<td align="center">0.516</td>
								<td align="center">0.275</td>
								<td align="center">0.080</td>
								<td align="center">0.077</td>
							</tr>
							<tr>
								<td>Interaction</td>
								<td align="center">0.676</td>
								<td align="center">0.073</td>
								<td align="center">0.507</td>
								<td align="center">0.571</td>
							</tr>
							<tr>
								<td>Pooled SEM</td>
								<td align="center">0.002</td>
								<td align="center">0.018</td>
								<td align="center">0.013</td>
								<td align="center">0.008</td>
							</tr>
						</tbody>
					</table>
					<table-wrap-foot>
						<fn id="TFN12">
							<p>SEM - standard error of mean.</p>
						</fn>
						<fn id="TFN13">
							<p><sup>1</sup> A,B - Differentiate selenium sources.</p>
						</fn>
						<fn id="TFN14">
							<p>* Dietary treatments that differ from the control diet by Dunnett's test (P&lt;0.05).</p>
						</fn>
					</table-wrap-foot>
				</table-wrap>
			</p>
			<p>Selenium supplementation affected selenium retention, with an interaction effect observed (P = 0.040). Diets supplemented with selenium proteinate or sodium selenite showed higher retention at 0.30 mg/kg. When 0.15 mg/kg of selenium was added, the inorganic source of selenium promoted greater retention compared to organic selenium. In contrast analyses, the control diet resulted in lower selenium retention (P&lt;0.05) than the other treatments. Diets with 0.30 mg/kg of selenium promoted greater excretion (P = 0.031) compared with diets containing 0.15 mg/kg. Compared with the control diet, diets with 0.30 mg/kg selenium proteinate and diets with sodium selenite at 0.15 and 0.30 mg/kg showed higher selenium excretion. Muscle selenium concentration was higher in pigs fed sodium selenite (P = 0.002) and at the 0.30 mg/kg level (P = 0.015). On the other hand, the control diet resulted in lower muscle selenium concentration compared with the diet containing 0.30 mg/kg sodium selenite (<xref ref-type="table" rid="t6">Table 6</xref>).</p>
			<p>
				<table-wrap id="t6">
					<label>Table 6</label>
					<caption>
						<title>Selenium retained, selenium excreted in feces, and selenium present in muscle and blood of piglets fed diets enriched with proteinate selenium (SeP) or sodium selenite (SeS) at two addition levels (0.15 or 0.30 mg/kg)</title>
					</caption>
					<table frame="hsides" rules="groups">
						<colgroup>
							<col/>
							<col/>
							<col/>
							<col/>
							<col/>
						</colgroup>
						<thead>
							<tr>
								<th align="left" rowspan="2" style="font-weight:normal"> </th>
								<th colspan="4" style="font-weight:normal">Selenium (mg/kg)</th>
							</tr>
							<tr>
								<th style="font-weight:normal">Retained</th>
								<th style="font-weight:normal">Excreted</th>
								<th style="font-weight:normal">Muscle</th>
								<th style="font-weight:normal">Blood</th>
							</tr>
						</thead>
						<tbody>
							<tr>
								<td>Dietary treatment<sup>1</sup></td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
							</tr>
							<tr>
								<td>Control diet</td>
								<td align="center">0.232</td>
								<td align="center">0.033</td>
								<td align="center">0.139</td>
								<td align="center">0.117</td>
							</tr>
							<tr>
								<td>SeP-0.15</td>
								<td align="center">0.361Ab*</td>
								<td align="center">0.043</td>
								<td align="center">0.131</td>
								<td align="center">0.121</td>
							</tr>
							<tr>
								<td>SeP-0.30</td>
								<td align="center">0.469Aa*</td>
								<td align="center">0.085*</td>
								<td align="center">0.144</td>
								<td align="center">0.135</td>
							</tr>
							<tr>
								<td>SeS-0.15</td>
								<td align="center">0.326Bb*</td>
								<td align="center">0.078*</td>
								<td align="center">0.143</td>
								<td align="center">0.119</td>
							</tr>
							<tr>
								<td>SeS-0.30</td>
								<td align="center">0.469Aa*</td>
								<td align="center">0.089*</td>
								<td align="center">0.186*</td>
								<td align="center">0.147</td>
							</tr>
							<tr>
								<td>Dietary Se source<sup>2</sup></td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
							</tr>
							<tr>
								<td>SeP</td>
								<td align="center">0.415</td>
								<td align="center">0.064</td>
								<td align="center">0.138B</td>
								<td align="center">0.128</td>
							</tr>
							<tr>
								<td>SeS</td>
								<td align="center">0.397</td>
								<td align="center">0.083</td>
								<td align="center">0.165A</td>
								<td align="center">0.133</td>
							</tr>
							<tr>
								<td>Dietary Se level<sup>2</sup></td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
							</tr>
							<tr>
								<td>0.15 (mg/kg)</td>
								<td align="center">0.344</td>
								<td align="center">0.061b</td>
								<td align="center">0.137b</td>
								<td align="center">0.120</td>
							</tr>
							<tr>
								<td>0.30 (mg/kg)</td>
								<td align="center">0.469</td>
								<td align="center">0.087a</td>
								<td align="center">0.165a</td>
								<td align="center">0.141</td>
							</tr>
							<tr>
								<td>ANOVA (P-value)</td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
							</tr>
							<tr>
								<td>Dietary Se source</td>
								<td align="center">0.023</td>
								<td align="center">0.074</td>
								<td align="center">0.002</td>
								<td align="center">0.353</td>
							</tr>
							<tr>
								<td>Dietary Se level</td>
								<td align="center">&lt;0.0001</td>
								<td align="center">0.031</td>
								<td align="center">0.015</td>
								<td align="center">0.331</td>
							</tr>
							<tr>
								<td>Interaction</td>
								<td align="center">0.040</td>
								<td align="center">0.114</td>
								<td align="center">0.191</td>
								<td align="center">0.461</td>
							</tr>
							<tr>
								<td>Pooled SEM</td>
								<td align="center">0.021</td>
								<td align="center">0.006</td>
								<td align="center">0.005</td>
								<td align="center">0.004</td>
							</tr>
						</tbody>
					</table>
					<table-wrap-foot>
						<fn id="TFN15">
							<p>SEM - standard error of mean.</p>
						</fn>
						<fn id="TFN16">
							<p><sup>1</sup> A,B - Differentiate selenium sources at each level (SeP-0.15 X SeS-0.15 and SeP-0.30 X SeS-0.30). a,b - Differentiate selenium levels in each source (SeP-0.15 X SeP-0.30 and SeS-0.15 X SeS-0.30).</p>
						</fn>
						<fn id="TFN17">
							<p><sup>2</sup> A,B - Differentiate selenium sources. a,b - Differentiate selenium levels.</p>
						</fn>
						<fn id="TFN18">
							<p>* Dietary treatments that differ from the control diet by Dunnett's test (P&lt;0.05).</p>
						</fn>
					</table-wrap-foot>
				</table-wrap>
			</p>
			<p>The addition of 0.30 mg/kg of selenium to diets resulted in lower VH (P = 0.001), VW (P = 0.001), CD (P&lt;0.0001) and mitotic rate (P = 0.031) in the duodenum. Compared with the control diet, diets with either selenium proteinate or sodium selenite at 0.30 mg/kg reduced VW (P&lt;0.05). In addition, the 0.30 mg/kg selenium proteinate diet reduced mitotic rate (P&lt;0.05), with fewer PCNA-positive cells in the jejunum (<xref ref-type="table" rid="t7">Table 7</xref>).</p>
			<p>
				<table-wrap id="t7">
					<label>Table 7</label>
					<caption>
						<title>Intestinal morphometry and mitosis rate in the duodenal epithelium of piglets fed diets enriched with proteinate selenium (SeP) or sodium selenite (SeS) at two addition levels (0.15 or 0.30 mg/kg)</title>
					</caption>
					<table frame="hsides" rules="groups">
						<colgroup>
							<col/>
							<col/>
							<col/>
							<col/>
							<col/>
							<col/>
						</colgroup>
						<thead>
							<tr>
								<th align="left" rowspan="2" style="font-weight:normal"> </th>
								<th colspan="5" style="font-weight:normal">Duodenum</th>
							</tr>
							<tr>
								<th style="font-weight:normal">VH (μm)</th>
								<th style="font-weight:normal">VW (μm)</th>
								<th style="font-weight:normal">CD (μm)</th>
								<th style="font-weight:normal">VH:CD</th>
								<th style="font-weight:normal">Mitosis (n°)</th>
							</tr>
						</thead>
						<tbody>
							<tr>
								<td>Dietary treatment</td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
							</tr>
							<tr>
								<td>Control diet</td>
								<td align="center">293.15</td>
								<td align="center">135.47</td>
								<td align="center">96.93</td>
								<td align="center">3.60</td>
								<td align="center">767.615</td>
							</tr>
							<tr>
								<td>SeP-0.15</td>
								<td align="center">273.46</td>
								<td align="center">120.98</td>
								<td align="center">101.06</td>
								<td align="center">2.98</td>
								<td align="center">752.802</td>
							</tr>
							<tr>
								<td>SeP-0.30</td>
								<td align="center">251.03</td>
								<td align="center">101.98*</td>
								<td align="center">92.44</td>
								<td align="center">2.90</td>
								<td align="center">619.232*</td>
							</tr>
							<tr>
								<td>SeS-0.15</td>
								<td align="center">298.10</td>
								<td align="center">116.08</td>
								<td align="center">97.41</td>
								<td align="center">2.94</td>
								<td align="center">909.812</td>
							</tr>
							<tr>
								<td>SeS-0.30</td>
								<td align="center">261.96</td>
								<td align="center">101.57*</td>
								<td align="center">88.25</td>
								<td align="center">3.12</td>
								<td align="center">860.389</td>
							</tr>
							<tr>
								<td>Dietary Se source</td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
							</tr>
							<tr>
								<td>SeP</td>
								<td align="center">262.24</td>
								<td align="center">111.48</td>
								<td align="center">96.75</td>
								<td align="center">2.94</td>
								<td align="center">686.017</td>
							</tr>
							<tr>
								<td>SeS</td>
								<td align="center">280.03</td>
								<td align="center">108.83</td>
								<td align="center">92.83</td>
								<td align="center">3.03</td>
								<td align="center">885.101</td>
							</tr>
							<tr>
								<td>Dietary Se level<sup>1</sup></td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
							</tr>
							<tr>
								<td>0.15 (mg/kg)</td>
								<td align="center">285.78a</td>
								<td align="center">118.53a</td>
								<td align="center">99.23a</td>
								<td align="center">2.96</td>
								<td align="center">831.307a</td>
							</tr>
							<tr>
								<td>0.30 (mg/kg)</td>
								<td align="center">256.49b</td>
								<td align="center">101.77b</td>
								<td align="center">90.34b</td>
								<td align="center">3.01</td>
								<td align="center">739.811b</td>
							</tr>
							<tr>
								<td>ANOVA (P-value)</td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
							</tr>
							<tr>
								<td>Dietary Se source</td>
								<td align="center">0.070</td>
								<td align="center">0.526</td>
								<td align="center">0.985</td>
								<td align="center">0.530</td>
								<td align="center">&lt;0.0001</td>
							</tr>
							<tr>
								<td>Dietary Se level</td>
								<td align="center">0.001</td>
								<td align="center">0.001</td>
								<td align="center">&lt;0.0001</td>
								<td align="center">0.769</td>
								<td align="center">0.031</td>
							</tr>
							<tr>
								<td>Interaction</td>
								<td align="center">0.480</td>
								<td align="center">0.675</td>
								<td align="center">0.240</td>
								<td align="center">0.403</td>
								<td align="center">0.314</td>
							</tr>
							<tr>
								<td>Pooled SEM</td>
								<td align="center">10.08</td>
								<td align="center">4.91</td>
								<td align="center">1.99</td>
								<td align="center">0.10</td>
								<td align="center">30.843</td>
							</tr>
						</tbody>
					</table>
					<table-wrap-foot>
						<fn id="TFN19">
							<p>VH - villus height; VW - villus width; CD - crypt depth; VH:CD - villus height:crypt depth ratio; SEM - standard error of mean.</p>
						</fn>
						<fn id="TFN20">
							<p><sup>1</sup> a,b - Differentiate selenium levels.</p>
						</fn>
						<fn id="TFN21">
							<p>* Dietary treatments that differ from the control diet by Dunnett's test (P&lt;0.05).</p>
						</fn>
					</table-wrap-foot>
				</table-wrap>
			</p>
			<p>There was an interaction effect (P = 0.027) for jejunal VW, where only diets with 0.30 mg/kg organic selenium reduced VW compared with 0.15 mg/kg. Compared with the control diet, both selenium sources at 0.30 mg/kg reduced VW. Crypt depth was higher in diets that added a selenium proteinate source over a sodium selenite source (P = 0.018), and in diets that added 0.30 mg/kg compared to 0.15 mg/kg (P = 0.024; <xref ref-type="table" rid="t8">Table 8</xref>).</p>
			<p>
				<table-wrap id="t8">
					<label>Table 8</label>
					<caption>
						<title>Intestinal morphometry and mitosis rate in the jejunum epithelium of piglets fed diets enriched with proteinate selenium (SeP) or sodium selenite (SeS) at two addition levels (0.15 or 0.30 mg/kg)</title>
					</caption>
					<table frame="hsides" rules="groups">
						<colgroup>
							<col/>
							<col/>
							<col/>
							<col/>
							<col/>
							<col/>
						</colgroup>
						<thead>
							<tr>
								<th align="left" rowspan="2" style="font-weight:normal"> </th>
								<th colspan="5" style="font-weight:normal">Jejunum</th>
							</tr>
							<tr>
								<th style="font-weight:normal">VH (μm)</th>
								<th style="font-weight:normal">VW (μm)</th>
								<th style="font-weight:normal">CD (μm)</th>
								<th style="font-weight:normal">VH:CD</th>
								<th style="font-weight:normal">Mitosis (n°)</th>
							</tr>
						</thead>
						<tbody>
							<tr>
								<td>Dietary treatment<sup>1</sup></td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
							</tr>
							<tr>
								<td>Control diet</td>
								<td align="center">218.69</td>
								<td align="center">107.60</td>
								<td align="center">87.97</td>
								<td align="center">2.68</td>
								<td align="center">872.645</td>
							</tr>
							<tr>
								<td>SeP-0.15</td>
								<td align="center">236.08</td>
								<td align="center">108.24Aa</td>
								<td align="center">96.30</td>
								<td align="center">2.68</td>
								<td align="center">955.480</td>
							</tr>
							<tr>
								<td>SeP-0.30</td>
								<td align="center">235.85</td>
								<td align="center">86.26Ab*</td>
								<td align="center">101.81</td>
								<td align="center">2.46</td>
								<td align="center">921.157</td>
							</tr>
							<tr>
								<td>SeS-0.15</td>
								<td align="center">217.78</td>
								<td align="center">95.64Aa</td>
								<td align="center">86.03</td>
								<td align="center">2.70</td>
								<td align="center">997.790</td>
							</tr>
							<tr>
								<td>SeS-0.30</td>
								<td align="center">229.33</td>
								<td align="center">90.10Aa*</td>
								<td align="center">96.67</td>
								<td align="center">2.51</td>
								<td align="center">916.568</td>
							</tr>
							<tr>
								<td>Dietary Se source<sup>2</sup></td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
							</tr>
							<tr>
								<td>SeP</td>
								<td align="center">235.97</td>
								<td align="center">97.25</td>
								<td align="center">99.06A</td>
								<td align="center">2.57</td>
								<td align="center">938.319</td>
							</tr>
							<tr>
								<td>SeS</td>
								<td align="center">223.55</td>
								<td align="center">92.87</td>
								<td align="center">91.35B</td>
								<td align="center">2.60</td>
								<td align="center">957.179</td>
							</tr>
							<tr>
								<td>Dietary Se level<sup>2</sup></td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
							</tr>
							<tr>
								<td>0.15 (mg/kg)</td>
								<td align="center">226.93</td>
								<td align="center">101.94</td>
								<td align="center">91.17b</td>
								<td align="center">2.69</td>
								<td align="center">976.635</td>
							</tr>
							<tr>
								<td>0.30 (mg/kg)</td>
								<td align="center">232.59</td>
								<td align="center">88.18</td>
								<td align="center">99.24a</td>
								<td align="center">2.49</td>
								<td align="center">918.862</td>
							</tr>
							<tr>
								<td>ANOVA (P-value)</td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
							</tr>
							<tr>
								<td>Dietary Se source</td>
								<td align="center">0.123</td>
								<td align="center">0.237</td>
								<td align="center">0.018</td>
								<td align="center">0.674</td>
								<td align="center">0.585</td>
							</tr>
							<tr>
								<td>Dietary Se level</td>
								<td align="center">0.564</td>
								<td align="center">&lt;0.0001</td>
								<td align="center">0.024</td>
								<td align="center">0.083</td>
								<td align="center">0.097</td>
							</tr>
							<tr>
								<td>Interaction</td>
								<td align="center">0.549</td>
								<td align="center">0.027</td>
								<td align="center">0.347</td>
								<td align="center">0.892</td>
								<td align="center">0.497</td>
							</tr>
							<tr>
								<td>Pooled SEM</td>
								<td align="center">6.80</td>
								<td align="center">3.27</td>
								<td align="center">2.71</td>
								<td align="center">0.10</td>
								<td align="center">29.008</td>
							</tr>
						</tbody>
					</table>
					<table-wrap-foot>
						<fn id="TFN22">
							<p>VH - villus height; VW - villus width; CD - crypt depth; VH:CD - villus height:crypt depth ratio; SEM - standard error of mean.</p>
						</fn>
						<fn id="TFN23">
							<p><sup>1</sup> A,B - Differentiate selenium sources at each level (SeP-0.15 X SeS-0.15 and SeP-0.30 X SeS-0.30). a,b - Differentiate selenium levels in each source (SeP-0.15 X SeP-0.30 and SeS-0.15 X SeS-0.30).</p>
						</fn>
						<fn id="TFN24">
							<p><sup>2</sup> A,B - Differentiate selenium sources. a,b - Differentiate selenium levels.</p>
						</fn>
						<fn id="TFN25">
							<p>* Dietary treatments that differ from the control diet by Dunnett's test (P&lt;0.05).</p>
						</fn>
					</table-wrap-foot>
				</table-wrap>
			</p>
			<p>There was an effect on cellular apoptosis (P = 0.020; <xref ref-type="fig" rid="f01">Figure 1</xref>). Lower cytoplasmic Caspase-3 positivity was observed in the jejunal epithelium of pigs fed selenium proteinate compared with inorganic selenium. When contrasted with the control diet, the diets with the inorganic selenium addition promoted a lower presence of cell apoptosis (P&lt;0.05).</p>
			<p>
				<fig id="f01">
					<label>Figure 1</label>
					<caption>
						<title>Apoptosis rate in the jejunal epithelium of piglets fed diets enriched with proteinate selenium (SeP) or sodium selenite (SeS) at two addition levels (0.15 or 0.30 mg/kg).</title>
					</caption>
					<graphic xlink:href="1806-9290-rbz-55-e20250039-gf01.tif"/>
					<attrib>A - control diet; B - SeP-0.15; C - SeS-0.15; D - SeP-0.30; E - SeS-0.30.</attrib>
					<attrib>A,B - Differentiate selenium sources.</attrib>
					<attrib>* Dietary treatments that differ from the control diet by Dunnett's test (P&lt;0.05).</attrib>
				</fig>
			</p>
			<p>At 41 days of age, serum GGT concentration was lower (P = 0.051) in pigs fed 0.30 mg/kg selenium, regardless of source. Other parameters were not influenced (P&gt;0.05) by the addition of selenium sources and levels, or even by concentration levels (<xref ref-type="table" rid="t9">Table 9</xref>). At 60 days of age (end of phase III), supplementation with 0.30 mg/kg selenium (regardless of source) increased serum CRC (P&lt;0.0001) and IgA (P = 0.015) concentrations. The 0.15 mg/kg selenium proteinate diet resulted in lower CRC concentration (P&lt;0.05) compared with the control, while the 0.15 mg/kg sodium selenite diet showed lower IgA concentration (P&lt;0.05) compared with the control (<xref ref-type="table" rid="t11">Table 10</xref>). The malondialdehyde levels present in the muscle and jejunum of the pigs were not influenced (P&gt;0.05) by the addition of selenium sources or levels.</p>
			<p>
				<table-wrap id="t9">
					<label>Table 9</label>
					<caption>
						<title>Serum biochemical parameters at 41 days of piglets fed diets enriched with proteinate selenium (SeP) or sodium selenite (SeS) at two addition levels (0.15 or 0.30 mg/kg)</title>
					</caption>
					<table frame="hsides" rules="groups">
						<colgroup>
							<col/>
							<col/>
							<col/>
							<col/>
							<col/>
							<col/>
						</colgroup>
						<thead>
							<tr>
								<th align="left" rowspan="2" style="font-weight:normal"> </th>
								<th colspan="5" style="font-weight:normal">41 days</th>
							</tr>
							<tr>
								<th style="font-weight:normal">GGT (U/dL)</th>
								<th style="font-weight:normal">AST (U/dL)</th>
								<th style="font-weight:normal">CRC (mg/dL)</th>
								<th style="font-weight:normal">IgG (mg/dL)</th>
								<th style="font-weight:normal">IgA (mg/dL)</th>
							</tr>
						</thead>
						<tbody>
							<tr>
								<td>Dietary treatment</td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
							</tr>
							<tr>
								<td>Control diet</td>
								<td align="center">8.11</td>
								<td align="center">9.17</td>
								<td align="center">2.15</td>
								<td align="center">488.3</td>
								<td align="center">47.73</td>
							</tr>
							<tr>
								<td>SeP-0.15</td>
								<td align="center">8.51</td>
								<td align="center">9.68</td>
								<td align="center">1.85</td>
								<td align="center">463.2</td>
								<td align="center">43.63</td>
							</tr>
							<tr>
								<td>SeP-0.30</td>
								<td align="center">7.83</td>
								<td align="center">9.52</td>
								<td align="center">2.20</td>
								<td align="center">483.4</td>
								<td align="center">46.93</td>
							</tr>
							<tr>
								<td>SeS-0.15</td>
								<td align="center">8.37</td>
								<td align="center">9.51</td>
								<td align="center">2.45</td>
								<td align="center">479.9</td>
								<td align="center">45.03</td>
							</tr>
							<tr>
								<td>SeS-0.30</td>
								<td align="center">7.46</td>
								<td align="center">8.54</td>
								<td align="center">2.50</td>
								<td align="center">487.7</td>
								<td align="center">45.63</td>
							</tr>
							<tr>
								<td>Dietary Se source</td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
							</tr>
							<tr>
								<td>SeP</td>
								<td align="center">8.17</td>
								<td align="center">9.60</td>
								<td align="center">2.03</td>
								<td align="center">473.3</td>
								<td align="center">45.28</td>
							</tr>
							<tr>
								<td>SeS</td>
								<td align="center">7.91</td>
								<td align="center">9.03</td>
								<td align="center">2.48</td>
								<td align="center">483.8</td>
								<td align="center">45.33</td>
							</tr>
							<tr>
								<td>Dietary Se level<sup>1</sup></td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
							</tr>
							<tr>
								<td>0.15 (mg/kg)</td>
								<td align="center">8.44a</td>
								<td align="center">9.59</td>
								<td align="center">2.15</td>
								<td align="center">471.5</td>
								<td align="center">44.33</td>
							</tr>
							<tr>
								<td>0.30 (mg/kg)</td>
								<td align="center">7.64b</td>
								<td align="center">9.03</td>
								<td align="center">2.35</td>
								<td align="center">485.6</td>
								<td align="center">46.28</td>
							</tr>
							<tr>
								<td>ANOVA (P-value)</td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
							</tr>
							<tr>
								<td>Dietary Se source</td>
								<td align="center">0.489</td>
								<td align="center">0.352</td>
								<td align="center">0.603</td>
								<td align="center">0.468</td>
								<td align="center">0.987</td>
							</tr>
							<tr>
								<td>Dietary Se level</td>
								<td align="center">0.051</td>
								<td align="center">0.356</td>
								<td align="center">0.256</td>
								<td align="center">0.336</td>
								<td align="center">0.517</td>
							</tr>
							<tr>
								<td>Interaction</td>
								<td align="center">0.748</td>
								<td align="center">0.505</td>
								<td align="center">0.695</td>
								<td align="center">0.664</td>
								<td align="center">0.651</td>
							</tr>
							<tr>
								<td>Pooled SEM</td>
								<td align="center">1.689</td>
								<td align="center">2.235</td>
								<td align="center">0.154</td>
								<td align="center">5.245</td>
								<td align="center">1.035</td>
							</tr>
						</tbody>
					</table>
					<table-wrap-foot>
						<fn id="TFN26">
							<p>GGT - gamma-glutamyltransferase; AST - aspartate aminotransferase; CRC - creatinine; IgA - immunoglobulin A; IgG - immunoglobulin G; SEM - standard error of mean.</p>
						</fn>
						<fn id="TFN27">
							<p><sup>1</sup> a,b - Differentiate selenium levels.</p>
						</fn>
					</table-wrap-foot>
				</table-wrap>
			</p>
			<p>
				<table-wrap id="t11">
					<label>Table 10</label>
					<caption>
						<title>Serum biochemical parameters at 60 days of piglets fed diets enriched with proteinate selenium (SeP) or sodium selenite (SeS) at two addition levels (0.15 or 0.30 mg/kg)</title>
					</caption>
					<table frame="hsides" rules="groups">
						<colgroup>
							<col/>
							<col/>
							<col/>
							<col/>
							<col/>
							<col/>
						</colgroup>
						<thead>
							<tr>
								<th align="left" rowspan="2" style="font-weight:normal"> </th>
								<th colspan="5" style="font-weight:normal">60 days</th>
							</tr>
							<tr>
								<th style="font-weight:normal">GGT (U/dL)</th>
								<th style="font-weight:normal">AST (U/dL)</th>
								<th style="font-weight:normal">CRC (mg/dL)</th>
								<th style="font-weight:normal">IgG (mg/dL)</th>
								<th style="font-weight:normal">IgA (mg/dL)</th>
							</tr>
						</thead>
						<tbody>
							<tr>
								<td>Dietary treatment</td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
							</tr>
							<tr>
								<td>Control diet</td>
								<td align="center">8.66</td>
								<td align="center">10.13</td>
								<td align="center">2.73</td>
								<td align="center">503.5</td>
								<td align="center">51.10</td>
							</tr>
							<tr>
								<td>SeP-0.15</td>
								<td align="center">8.96</td>
								<td align="center">10.21</td>
								<td align="center">2.43*</td>
								<td align="center">497.1</td>
								<td align="center">46.97</td>
							</tr>
							<tr>
								<td>SeP-0.30</td>
								<td align="center">8.89</td>
								<td align="center">9.90</td>
								<td align="center">2.80</td>
								<td align="center">503.6</td>
								<td align="center">50.05</td>
							</tr>
							<tr>
								<td>SeS-0.15</td>
								<td align="center">9.17</td>
								<td align="center">10.60</td>
								<td align="center">2.55</td>
								<td align="center">502.6</td>
								<td align="center">41.48*</td>
							</tr>
							<tr>
								<td>SeS-0.30</td>
								<td align="center">8.69</td>
								<td align="center">9.65</td>
								<td align="center">2.85</td>
								<td align="center">503.1</td>
								<td align="center">50.40</td>
							</tr>
							<tr>
								<td>Dietary Se source</td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
							</tr>
							<tr>
								<td>SeP</td>
								<td align="center">8.92</td>
								<td align="center">10.05</td>
								<td align="center">2.62</td>
								<td align="center">500.4</td>
								<td align="center">48.51</td>
							</tr>
							<tr>
								<td>SeS</td>
								<td align="center">8.93</td>
								<td align="center">10.12</td>
								<td align="center">2.70</td>
								<td align="center">502.8</td>
								<td align="center">45.94</td>
							</tr>
							<tr>
								<td>Dietary Se level<sup>1</sup></td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
							</tr>
							<tr>
								<td>0.15 (mg/kg)</td>
								<td align="center">9.06</td>
								<td align="center">10.40</td>
								<td align="center">2.49b</td>
								<td align="center">499.9</td>
								<td align="center">44.22b</td>
							</tr>
							<tr>
								<td>0.30 (mg/kg)</td>
								<td align="center">8.79</td>
								<td align="center">9.77</td>
								<td align="center">2.83a</td>
								<td align="center">503.3</td>
								<td align="center">50.23a</td>
							</tr>
							<tr>
								<td>ANOVA (P-value)</td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
							</tr>
							<tr>
								<td>Dietary Se source</td>
								<td align="center">0.948</td>
								<td align="center">0.894</td>
								<td align="center">0.226</td>
								<td align="center">0.197</td>
								<td align="center">0.348</td>
							</tr>
							<tr>
								<td>Dietary Se level</td>
								<td align="center">0.370</td>
								<td align="center">0.132</td>
								<td align="center">&lt;0.0001</td>
								<td align="center">0.089</td>
								<td align="center">0.015</td>
							</tr>
							<tr>
								<td>Interaction</td>
								<td align="center">0.438</td>
								<td align="center">0.463</td>
								<td align="center">0.697</td>
								<td align="center">0.180</td>
								<td align="center">0.278</td>
							</tr>
							<tr>
								<td>Pooled SEM</td>
								<td align="center">1.045</td>
								<td align="center">1.690</td>
								<td align="center">0.045</td>
								<td align="center">0.793</td>
								<td align="center">1.185</td>
							</tr>
						</tbody>
					</table>
					<table-wrap-foot>
						<fn id="TFN28">
							<p>GGT - gamma-glutamyltransferase; AST - aspartate aminotransferase; CRC - creatinine; IgA - immunoglobulin A; IgG - immunoglobulin G; SEM - standard error of mean.</p>
						</fn>
						<fn id="TFN29">
							<p><sup>1</sup> a,b - Differentiate selenium levels.</p>
						</fn>
					</table-wrap-foot>
				</table-wrap>
			</p>
			<p>Gene expression of GPX1 and GPX2 in the jejunal epithelium was not affected (P&gt;0.05) by selenium supplementation at 0.15 or 0.30 mg/kg (<xref ref-type="fig" rid="f02">Figure 2</xref>). Hepatic GPX1 expression was significantly higher (P&lt;0.05) in pigs fed 0.30 mg/kg sodium selenite compared with the control diet (<xref ref-type="fig" rid="f03">Figure 3</xref>). Hepatic SePP expression was significantly higher (P&lt;0.05) in diets with 0.15 or 0.30 mg/kg sodium selenite compared with the control diet. Selenium source influenced the SePP expression (P = 0.038), with sodium selenite promoting higher hepatic SePP expression than selenium proteinate. Hepatic GPX4 expression was not affected (P&gt;0.05) by the experimental diets.</p>
			<p>
				<fig id="f02">
					<label>Figure 2</label>
					<caption>
						<title>mRNA expression of glutathione peroxidase 1 (GPX1) and glutathione peroxidase 2 (GPX2) in the jejunal epithelium of piglets fed diets enriched with proteinate selenium (SeP) or sodium selenite (SeS) at two addition levels (0.15 or 0.30 mg/kg).</title>
					</caption>
					<graphic xlink:href="1806-9290-rbz-55-e20250039-gf02.tif"/>
				</fig>
			</p>
			<p>
				<fig id="f03">
					<label>Figure 3</label>
					<caption>
						<title>mRNA expression of glutathione peroxidase 1 (GPX1), glutathione peroxidase 4 (GPX4) and selenoprotein P (SePP) in the liver tissue of piglets fed diets enriched with proteinate selenium (SeP) or sodium selenite (SeS) at two addition levels (0.15 or 0.30 mg/kg).</title>
					</caption>
					<graphic xlink:href="1806-9290-rbz-55-e20250039-gf03.tif"/>
					<attrib>A,B - Differentiate selenium sources.</attrib>
					<attrib>* Dietary treatments that differ from the control diet by Dunnett's test (P&lt;0.05).</attrib>
				</fig>
			</p>
		</sec>
		<sec sec-type="discussion">
			<title>4. Discussion</title>
			<p>The highest selenium level (0.30 mg/kg) reduced ADFI and consequently ADG. Supplementation with 0.30 mg/kg selenium proteinate, in particular, reduced ADFI in both evaluated phases. A similar result was found by <xref ref-type="bibr" rid="B19">Rao et al. (2023)</xref> using selenomethionine the organic selenium source in piglet diets. <xref ref-type="bibr" rid="B14">Lyons et al. (2007)</xref> concluded that organic selenium sources are more bioavailable than inorganic ones, and therefore <xref ref-type="bibr" rid="B22">Rostagno et al. (2017)</xref> recommend 0.233 mg/kg selenium for newly weaned piglets when the source is organic, compared with 0.517 mg/kg for inorganic sources. In that study, the diets with the addition of 0.30 mg/kg of selenium had a selenium concentration of 0.576 mg/kg in their composition, resulting in values above the recommended level for organic sources (0.233 mg/kg), but close to that recommended for inorganic sources (0.517 mg/kg). The diets supplemented with organic selenium worsened the feed conversion of the animals from 28 to 60 days. This contrasts with <xref ref-type="bibr" rid="B26">Shen et al. (2009)</xref>, who observed improved feed conversion with organic selenium supplementation, and <xref ref-type="bibr" rid="B3">Cao et al. (2014)</xref>, who reported better feed conversion with selenomethionine-enriched diets.</p>
			<p>Selenium proteinate improved dry matter digestibility in our study, which is similar to the results found by <xref ref-type="bibr" rid="B26">Shen et al. (2009)</xref> in evaluating the digestibility of pigs in the initial phase. They reported that a diet supplemented with selenium and yeast improved the dry matter, crude energy and crude protein digestibility. A reduction in feed intake by pigs fed a diet supplemented with 0.30 mg/kg of selenium may have influenced the digestibility of nutrients, as discussed by <xref ref-type="bibr" rid="B11">Li and Patience (2017)</xref>. Changes in the intestinal microbiota may also have altered nutrient digestibility, since selenium is able to influence the microbiota as reported by <xref ref-type="bibr" rid="B17">Pereira et al. (2020)</xref>. Nutrients not digested and absorbed in the small intestine are fermented in the colon by the local microbiota (<xref ref-type="bibr" rid="B31">Wernimont et al., 2020</xref>), probably affecting the total apparent digestibility, which does not discriminate the contribution of microbial communities to nutrient digestibility.</p>
			<p>The selenium concentrations in the diets with the addition of sources were higher than the recommendations of the <xref ref-type="bibr" rid="B15">NRC (2012)</xref> and by <xref ref-type="bibr" rid="B22">Rostagno et al. (2017)</xref> in seeking the effect on immune parameters and expression of selenoproteins related to antioxidant control. Therefore, there was greater selenium retention in all diets with selenium proteinate or sodium selenite added; on the other hand, diets with sodium selenite source addition and the diet with 0.30 mg/kg of selenium proteinate added provided greater selenium excretion than the control diet, indicating that there were other mechanisms in addition to the ADFI reduction to avoid toxicity due to excess selenium in the diet. Higher selenium retention resulted in greater muscle deposition, with tissue selenium concentration being higher with selenium proteinate than with sodium selenite, while the 30 mg/kg of selenium addition also increased the muscle concentration of selenium in relation to addition of 0.15 mg/kg. Our results are in line with those found in the literature. <xref ref-type="bibr" rid="B19">Rao et al. (2023)</xref> observed that an organic source of selenium resulted in higher selenium deposition in the tissue of piglets in the initial phase; <xref ref-type="bibr" rid="B35">Zhang et al. (2020)</xref> reported that sources and levels affect selenium concentrations deposited in the muscle, while <xref ref-type="bibr" rid="B27">Son et al. (2018)</xref> found that the selenium concentration level in the diet is directly correlated with concentrations in plasma, hair, liver, kidneys, muscles and urine of pigs.</p>
			<p>Intestinal morphology is directly related to mitotic rate. Reduced villus height and width, as well as lower crypt depth in the duodenal epithelium of the pigs fed diets with 0.30 mg/kg selenium addition are related to the lower cell mitosis rate in the pigs with the same treatment. The reduced DFI observed in pigs fed 0.30 mg/kg selenium may have contributed that affected the morphology and cell mitosis in the epithelium of the pigs, since the intestinal segments need to obtain enough nutrients to meet the demands of mucosal protein synthesis and growth, causing shortening and modification in the villi structure and hyperplasia of the crypt cells (<xref ref-type="bibr" rid="B18">Pluske et al., 1997</xref>; <xref ref-type="bibr" rid="B12">Lin et al., 2014</xref>).</p>
			<p>Supplementation with a sodium selenite source reduced the CD in the jejunal epithelium compared to selenium proteinate, whereas supplementation with 0.30 mg/kg of selenium reduced the villi width compared to the control diet. There is a relationship between DFI and intestinal morphology, similar to what occurred in the duodenal epithelium, however this response is also linked to the apoptosis rate, which was lower in the jejunal epithelium of pigs fed a diet supplemented with sodium selenite in relation to selenium proteinate and control diet. Gut morphology is linked to cell turnover (<xref ref-type="bibr" rid="B18">Pluske et al., 1997</xref>). Thus, apoptosis can influence crypt mitosis rate in the crypts, and consequently the values of villus height and crypt depth. For this reason, the highest selenium additional level can cause exaggerated inhibitory activity of oxidative processes, influencing the normal behavior of cell turnover in the intestinal epithelium.</p>
			<p>Metabolic biomarkers are indicative of possible disturbances to the detriment of animal nutrition. AST and GGT enzymes are considered important markers of liver function and for evaluating the enzymatic metabolic profile, but damage to the liver tissue causes these enzymes to leak into the systemic circulation, thus altering their serum levels (<xref ref-type="bibr" rid="B28">Tennant and Center, 2008</xref>). It has already been reported in our study that the 0.30 mg/kg selenium addition in the diet resulted in DFI reduction mechanisms and increased selenium excretion, suggesting that this level may exceed the optimal threshold for piglets. CRC concentrations are considered normal for pigs between 1.0 and 2.7 U/dL (<xref ref-type="bibr" rid="B9">Kaneko et al., 2008</xref>). In this study, supplementation with 0.30 mg/kg selenium resulted in 2.83 U/dL, differing from the lower levels. Very high creatinine levels in the blood indicate impairment in kidney functionality, which may have been altered with the higher selenium level. The serum IgA concentration at 60 days was higher in pigs fed diets supplemented with 0.30 mg/kg of selenium, which is in line with the GGT and CRC results; however, the levels of antibodies found are below those suggested by <xref ref-type="bibr" rid="B30">Tizard (2019)</xref>. In a study using selenomethionine at levels of 0.1 to 0.7 mg/kg of selenium, <xref ref-type="bibr" rid="B3">Cao et al. (2014)</xref> did not observe an effect on the IGA, IGG and IGM levels; nevertheless, the serum concentrations of these antibodies were higher than those found in our study.</p>
			<p>The first selenoprotein identified in mammals was GPX1 (<xref ref-type="bibr" rid="B23">Rotruck et al., 1973</xref>). Together with GPX4, it is also the most abundant selenoproteins in various immune cells and tissues (<xref ref-type="bibr" rid="B5">Hoffmann et al., 2007</xref>; <xref ref-type="bibr" rid="B4">Carlson et al., 2010</xref>). GPX1 and GPX4 are expressed in most tissues, while GPX2 is mainly expressed in the epithelium of the gastrointestinal tract (<xref ref-type="bibr" rid="B10">Koyama et al., 1999</xref>). Although there was no difference in the GPX1 and GPX2 expression in the jejunal epithelium of the pigs in relation to the selenium addition sources or levels, GPX1 in the liver was more expressed when the pigs were fed a diet enriched with 0.30 mg/kg of sodium selenite compared to the control diet; this may have occurred due to GPX1 being more involved in antioxidant processes, being considered an essential selenoprotein. Furthermore, in the case of a change in selenium supplementation, its expression is prioritized to the detriment of other selenoproteins (<xref ref-type="bibr" rid="B25">Schomburg and Schweizer, 2009</xref>).</p>
			<p>Hepatic SePP was directly influenced by the addition of sodium selenite in the diets compared to the addition of selenium proteinate and the control diet. SePP is synthesized in many different tissues, but it serves as a key transporter of selenium in the liver where hepatic SePP is secreted into plasma which does the transport, which in turn influences selenium homeostasis throughout the body (<xref ref-type="bibr" rid="B25">Schomburg and Schweizer, 2009</xref>). In our study, it was observed that the addition of sodium selenite resulted in greater selenium deposition in the muscle, as it is not complexed to an organic molecule; sodium selenite must be quickly transported to be excreted or deposited in the tissue, and so there is a greater expression of SePP to transport this selenium and maintain body homeostasis. There is also growing evidence that SePP not only transports selenium, but also plays crucial antioxidant roles, which are particularly important for certain immune functions (<xref ref-type="bibr" rid="B6">Huang et al., 2012</xref>).</p>
		</sec>
		<sec sec-type="conclusions">
			<title>5. Conclusions</title>
			<p>At high concentrations, sodium selenite increases the expression of hepatic selenium-transporting selenoproteins, as well as serum creatinine and immunoglobulin A concentrations. Sodium selenite supplementation at 0.30 mg/kg may induce adverse effects, including altered intestinal morphology and kidney biomarkers. Selenium proteinate at 0.15 mg/kg appears to be a safer and more effective supplemental level, and its use is recommended as a dietary source of selenium at up to 0.15 mg/kg.</p>
		</sec>
	</body>
	<back>
		<ack>
			<title>Acknowledgments</title>
			<p>The authors acknowledge the Universidade Federal da Paraíba (UFPB) for access to the bibliographic collection used and for the access to laboratories during the execution of this work.</p>
		</ack>
		<ref-list>
			<title>References</title>
			<ref id="B1">
				<mixed-citation>Adeola, O. 2000. Digestion and balance techniques in pigs: Swine nutrition. 2nd ed. CRC Press, Boca Raton.</mixed-citation>
				<element-citation publication-type="book">
					<person-group person-group-type="author">
						<name>
							<surname>Adeola</surname>
							<given-names>O</given-names>
						</name>
					</person-group>
					<year>2000</year>
					<source>Digestion and balance techniques in pigs: Swine nutrition</source>
					<edition>2nd</edition>
					<publisher-name>CRC Press</publisher-name>
					<publisher-loc>Boca Raton</publisher-loc>
				</element-citation>
			</ref>
			<ref id="B2">
				<mixed-citation>AOAC - Association of Official Analytical Chemists. 2006. Official methods of analysis of AOAC International. 18th ed. AOAC International, Gaithersburg, MD.</mixed-citation>
				<element-citation publication-type="report">
					<person-group person-group-type="author">
						<collab>AOAC - Association of Official Analytical Chemists</collab>
					</person-group>
					<year>2006</year>
					<source>Official methods of analysis of AOAC International</source>
					<edition>18th</edition>
					<publisher-name>AOAC International</publisher-name>
					<publisher-loc>Gaithersburg, MD</publisher-loc>
				</element-citation>
			</ref>
			<ref id="B3">
				<mixed-citation>Cao, J.; Guo, F.; Zhang, L.; Dong, B. and Gong, L. 2014. Effects of dietary Selenomethionine supplementation on growth performance, antioxidant status, plasma selenium concentration, and immune function in weaning pigs. Journal of Animal Science and Biotechnology 5:46. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1186/2049-1891-5-46">https://doi.org/10.1186/2049-1891-5-46</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Cao</surname>
							<given-names>J.</given-names>
						</name>
						<name>
							<surname>Guo</surname>
							<given-names>F.</given-names>
						</name>
						<name>
							<surname>Zhang</surname>
							<given-names>L.</given-names>
						</name>
						<name>
							<surname>Dong</surname>
							<given-names>B.</given-names>
						</name>
						<name>
							<surname>Gong</surname>
							<given-names>L.</given-names>
						</name>
					</person-group>
					<year>2014</year>
					<article-title>Effects of dietary Selenomethionine supplementation on growth performance, antioxidant status, plasma selenium concentration, and immune function in weaning pigs</article-title>
					<source>Journal of Animal Science and Biotechnology</source>
					<volume>5</volume>
					<size units="pages">46</size>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1186/2049-1891-5-46">https://doi.org/10.1186/2049-1891-5-46</ext-link>
					</comment>
				</element-citation>
			</ref>
			<ref id="B4">
				<mixed-citation>Carlson, B. A.; Yoo, M.-H.; Shrimali, R. K.; Irons, R.; Gladyshev, V. N.; Hatfield, D. L. and Park, J. M. 2010. Role of selenium-containing proteins in T-cell and macrophage function. Proceedings of the Nutrition Society 69:300-310. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1017/S002966511000176X">https://doi.org/10.1017/S002966511000176X</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Carlson</surname>
							<given-names>B. A.</given-names>
						</name>
						<name>
							<surname>Yoo</surname>
							<given-names>M.-H.</given-names>
						</name>
						<name>
							<surname>Shrimali</surname>
							<given-names>R. K.</given-names>
						</name>
						<name>
							<surname>Irons</surname>
							<given-names>R.</given-names>
						</name>
						<name>
							<surname>Gladyshev</surname>
							<given-names>V. N.</given-names>
						</name>
						<name>
							<surname>Hatfield</surname>
							<given-names>D. L.</given-names>
						</name>
						<name>
							<surname>Park</surname>
							<given-names>J. M.</given-names>
						</name>
					</person-group>
					<year>2010</year>
					<article-title>Role of selenium-containing proteins in T-cell and macrophage function</article-title>
					<source>Proceedings of the Nutrition Society</source>
					<volume>69</volume>
					<fpage>300</fpage>
					<lpage>310</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1017/S002966511000176X">https://doi.org/10.1017/S002966511000176X</ext-link>
					</comment>
				</element-citation>
			</ref>
			<ref id="B5">
				<mixed-citation>Hoffmann, P. R.; Höge, S. C.; Li, P.-A.; Hoffmann, F. W.; Hashimoto, A. C. and Berry, M. J. 2007. The selenoproteome exhibits widely varying, tissue-specific dependence on selenoprotein P for selenium supply. Nucleic Acids Research 35:3963-3973. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1093/nar/gkm355">https://doi.org/10.1093/nar/gkm355</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Hoffmann</surname>
							<given-names>P. R.</given-names>
						</name>
						<name>
							<surname>Höge</surname>
							<given-names>S. C.</given-names>
						</name>
						<name>
							<surname>Li</surname>
							<given-names>P.-A.</given-names>
						</name>
						<name>
							<surname>Hoffmann</surname>
							<given-names>F. W.</given-names>
						</name>
						<name>
							<surname>Hashimoto</surname>
							<given-names>A. C.</given-names>
						</name>
						<name>
							<surname>Berry</surname>
							<given-names>M. J.</given-names>
						</name>
					</person-group>
					<year>2007</year>
					<article-title>The selenoproteome exhibits widely varying, tissue-specific dependence on selenoprotein P for selenium supply</article-title>
					<source>Nucleic Acids Research</source>
					<volume>35</volume>
					<fpage>3963</fpage>
					<lpage>3973</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1093/nar/gkm355">https://doi.org/10.1093/nar/gkm355</ext-link>
					</comment>
				</element-citation>
			</ref>
			<ref id="B6">
				<mixed-citation>Huang, Z.; Rose, A. H. and Hoffmann, P. R. 2012. The role of selenium in inflammation and immunity: from molecular mechanisms to therapeutic opportunities. Antioxidants &amp; Redox Signaling 16:705-743.</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Huang</surname>
							<given-names>Z.</given-names>
						</name>
						<name>
							<surname>Rose</surname>
							<given-names>A. H.</given-names>
						</name>
						<name>
							<surname>Hoffmann</surname>
							<given-names>P. R.</given-names>
						</name>
					</person-group>
					<year>2012</year>
					<article-title>The role of selenium in inflammation and immunity: from molecular mechanisms to therapeutic opportunities</article-title>
					<source>Antioxidants &amp; Redox Signaling</source>
					<volume>16</volume>
					<fpage>705</fpage>
					<lpage>743</lpage>
				</element-citation>
			</ref>
			<ref id="B7">
				<mixed-citation>Ishak, K.; Baptista, A.; Bianchi, L.; Callea, F.; De Groote, J.; Gudat, F.; Denk, H.; Desmet, V.; Korb, G.; MacSween, R. N. M.; Phillips, M. J.; Portmann, B. G.; Poulsen, H.; Scheuer, P. J.; Schmid, M. and Thaler, H. 1995. Histological grading and staging of chronic hepatitis. Journal of Hepatology 22:696-699. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1016/0168-8278(95)80226-6">https://doi.org/10.1016/0168-8278 (95)80226-6</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Ishak</surname>
							<given-names>K.</given-names>
						</name>
						<name>
							<surname>Baptista</surname>
							<given-names>A.</given-names>
						</name>
						<name>
							<surname>Bianchi</surname>
							<given-names>L.</given-names>
						</name>
						<name>
							<surname>Callea</surname>
							<given-names>F.</given-names>
						</name>
						<name>
							<surname>De Groote</surname>
							<given-names>J.</given-names>
						</name>
						<name>
							<surname>Gudat</surname>
							<given-names>F.</given-names>
						</name>
						<name>
							<surname>Denk</surname>
							<given-names>H.</given-names>
						</name>
						<name>
							<surname>Desmet</surname>
							<given-names>V.</given-names>
						</name>
						<name>
							<surname>Korb</surname>
							<given-names>G.</given-names>
						</name>
						<name>
							<surname>MacSween</surname>
							<given-names>R. N. M.</given-names>
						</name>
						<name>
							<surname>Phillips</surname>
							<given-names>M. J.</given-names>
						</name>
						<name>
							<surname>Portmann</surname>
							<given-names>B. G.</given-names>
						</name>
						<name>
							<surname>Poulsen</surname>
							<given-names>H.</given-names>
						</name>
						<name>
							<surname>Scheuer</surname>
							<given-names>P. J.</given-names>
						</name>
						<name>
							<surname>Schmid</surname>
							<given-names>M.</given-names>
						</name>
						<name>
							<surname>Thaler</surname>
							<given-names>H.</given-names>
						</name>
					</person-group>
					<year>1995</year>
					<article-title>Histological grading and staging of chronic hepatitis</article-title>
					<source>Journal of Hepatology</source>
					<volume>22</volume>
					<fpage>696</fpage>
					<lpage>699</lpage>
					<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1016/0168-8278(95)80226-6">https://doi.org/10.1016/0168-8278 (95)80226-6</ext-link>
				</element-citation>
			</ref>
			<ref id="B8">
				<mixed-citation>Jang, Y. D.; Choi, H. B.; Durosoy, S.; Schlegel, P.; Choi, B. R. and Kim, Y. Y. 2010. Comparison of bioavailability of organic selenium sources in finishing pigs. Asian-Australasian Journal of Animal Sciences 23:931-936. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.5713/ajas.2010.90619">https://doi.org/10.5713/ajas.2010.90619</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Jang</surname>
							<given-names>Y. D.</given-names>
						</name>
						<name>
							<surname>Choi</surname>
							<given-names>H. B.</given-names>
						</name>
						<name>
							<surname>Durosoy</surname>
							<given-names>S.</given-names>
						</name>
						<name>
							<surname>Schlegel</surname>
							<given-names>P.</given-names>
						</name>
						<name>
							<surname>Choi</surname>
							<given-names>B. R.</given-names>
						</name>
						<name>
							<surname>Kim</surname>
							<given-names>Y. Y.</given-names>
						</name>
					</person-group>
					<year>2010</year>
					<article-title>Comparison of bioavailability of organic selenium sources in finishing pigs</article-title>
					<source>Asian-Australasian Journal of Animal Sciences</source>
					<volume>23</volume>
					<fpage>931</fpage>
					<lpage>936</lpage>
					<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.5713/ajas.2010.90619">https://doi.org/10.5713/ajas.2010.90619</ext-link>
				</element-citation>
			</ref>
			<ref id="B9">
				<mixed-citation>Kaneko, J. J.; Harvey, J. W. and Bruss, M. L. 2008. Clinical biochemistry of domestic animals. 6th ed. Academic Press, San Diego.</mixed-citation>
				<element-citation publication-type="book">
					<person-group person-group-type="author">
						<name>
							<surname>Kaneko</surname>
							<given-names>J. J.</given-names>
						</name>
						<name>
							<surname>Harvey</surname>
							<given-names>J. W.</given-names>
						</name>
						<name>
							<surname>Bruss</surname>
							<given-names>M. L.</given-names>
						</name>
					</person-group>
					<year>2008</year>
					<source>Clinical biochemistry of domestic animals</source>
					<edition>6th</edition>
					<publisher-name>Academic Press</publisher-name>
					<publisher-loc>San Diego</publisher-loc>
				</element-citation>
			</ref>
			<ref id="B10">
				<mixed-citation>Koyama, H.; Omura, K.; Ejima, A.; Kasanuma, Y.; Watanabe, C. and Satoh, H. 1999. Separation of selenium-containing proteins in human and mouse plasma using tandem high-performance liquid chromatography columns coupled with inductively coupled plasma-mass spectrometry. Analytical Biochemistry 267:84-91. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1006/abio.1998.2949">https://doi.org/10.1006/abio.1998.2949</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Koyama</surname>
							<given-names>H.</given-names>
						</name>
						<name>
							<surname>Omura</surname>
							<given-names>K.</given-names>
						</name>
						<name>
							<surname>Ejima</surname>
							<given-names>A.</given-names>
						</name>
						<name>
							<surname>Kasanuma</surname>
							<given-names>Y.</given-names>
						</name>
						<name>
							<surname>Watanabe</surname>
							<given-names>C.</given-names>
						</name>
						<name>
							<surname>Satoh</surname>
							<given-names>H.</given-names>
						</name>
					</person-group>
					<year>1999</year>
					<article-title>Separation of selenium-containing proteins in human and mouse plasma using tandem high-performance liquid chromatography columns coupled with inductively coupled plasma-mass spectrometry</article-title>
					<source>Analytical Biochemistry</source>
					<volume>267</volume>
					<fpage>84</fpage>
					<lpage>91</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1006/abio.1998.2949">https://doi.org/10.1006/abio.1998.2949</ext-link>
					</comment>
				</element-citation>
			</ref>
			<ref id="B11">
				<mixed-citation>Li, Q. and Patience, J. F. 2017. Factors involved in the regulation of feed and energy intake of pigs. Animal Feed Science and Technology 233:22-33. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1016/j.anifeedsci.2016.01.001">https://doi.org/10.1016/j.anifeedsci.2016.01.001</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Li</surname>
							<given-names>Q.</given-names>
						</name>
						<name>
							<surname>Patience</surname>
							<given-names>J. F.</given-names>
						</name>
					</person-group>
					<year>2017</year>
					<article-title>Factors involved in the regulation of feed and energy intake of pigs</article-title>
					<source>Animal Feed Science and Technology</source>
					<volume>233</volume>
					<fpage>22</fpage>
					<lpage>33</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1016/j.anifeedsci.2016.01.001">https://doi.org/10.1016/j.anifeedsci.2016.01.001</ext-link>
					</comment>
				</element-citation>
			</ref>
			<ref id="B12">
				<mixed-citation>Lin, M.; Zhang, B.; Yu, C.; Li, J.; Zhang, L.; Sun, H.; Gao, F. and Zhou, G. 2014. L-glutamate supplementation improves small intestinal architecture and enhances the expressions of jejunal mucosa amino acid receptors and transporters in weaning piglets. PLoS ONE 9:e111950. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1371/journal.pone.0111950">https://doi.org/10.1371/journal.pone.0111950</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Lin</surname>
							<given-names>M.</given-names>
						</name>
						<name>
							<surname>Zhang</surname>
							<given-names>B.</given-names>
						</name>
						<name>
							<surname>Yu</surname>
							<given-names>C.</given-names>
						</name>
						<name>
							<surname>Li</surname>
							<given-names>J.</given-names>
						</name>
						<name>
							<surname>Zhang</surname>
							<given-names>L.</given-names>
						</name>
						<name>
							<surname>Sun</surname>
							<given-names>H.</given-names>
						</name>
						<name>
							<surname>Gao</surname>
							<given-names>F.</given-names>
						</name>
						<name>
							<surname>Zhou</surname>
							<given-names>G.</given-names>
						</name>
					</person-group>
					<year>2014</year>
					<article-title>L-glutamate supplementation improves small intestinal architecture and enhances the expressions of jejunal mucosa amino acid receptors and transporters in weaning piglets</article-title>
					<source>PLoS ONE</source>
					<volume>9</volume>
					<elocation-id>e111950</elocation-id>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1371/journal.pone.0111950">https://doi.org/10.1371/journal.pone.0111950</ext-link>
					</comment>
				</element-citation>
			</ref>
			<ref id="B13">
				<mixed-citation>Livak, K. J. and Schmittgen, T. D. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2 -??CT method. Methods 25:402-408. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1006/meth.2001.1262">https://doi.org/10.1006/meth.2001.1262</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Livak</surname>
							<given-names>K. J.</given-names>
						</name>
						<name>
							<surname>Schmittgen</surname>
							<given-names>T. D.</given-names>
						</name>
					</person-group>
					<year>2001</year>
					<article-title>Analysis of relative gene expression data using real-time quantitative PCR and the 2 -??CT method</article-title>
					<source>Methods</source>
					<volume>25</volume>
					<fpage>402</fpage>
					<lpage>408</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1006/meth.2001.1262">https://doi.org/10.1006/meth.2001.1262</ext-link>
					</comment>
				</element-citation>
			</ref>
			<ref id="B14">
				<mixed-citation>Lyons, M. P.; Papazyan, T. T. and Surai, P. F. 2007. Selenium in food chain and animal nutrition: Lessons from nature -Review-. Asian-Australasian Journal of Animal Sciences 20:1135-1155. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.5713/ajas.2007.1135">https://doi.org/10.5713/ajas.2007.1135</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Lyons</surname>
							<given-names>M. P.</given-names>
						</name>
						<name>
							<surname>Papazyan</surname>
							<given-names>T. T.</given-names>
						</name>
						<name>
							<surname>Surai</surname>
							<given-names>P. F.</given-names>
						</name>
					</person-group>
					<year>2007</year>
					<article-title>Selenium in food chain and animal nutrition: Lessons from nature -Review-</article-title>
					<source>Asian-Australasian Journal of Animal Sciences</source>
					<volume>20</volume>
					<fpage>1135</fpage>
					<lpage>1155</lpage>
					<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.5713/ajas.2007.1135">https://doi.org/10.5713/ajas.2007.1135</ext-link>
				</element-citation>
			</ref>
			<ref id="B15">
				<mixed-citation>NRC - National Research Council. 2012. Nutrient requirements of swine. 11th ed. National Academies Press, Washington, DC.</mixed-citation>
				<element-citation publication-type="report">
					<person-group person-group-type="author">
						<collab>NRC - National Research Council</collab>
					</person-group>
					<year>2012</year>
					<source>Nutrient requirements of swine</source>
					<edition>11th</edition>
					<publisher-name>National Academies Press</publisher-name>
					<publisher-loc>Washington, DC</publisher-loc>
				</element-citation>
			</ref>
			<ref id="B16">
				<mixed-citation>Pascoal, L. A. F.; Thomaz, M. C.; Watanabe, P. H.; Ruiz, U. S.; Ezequiel, J. M. B.; Amorim, A. B.; Daniel, E. and Masson, G. C. I. 2012. Fiber sources in diets for newly weaned piglets. Revista Brasileira de Zootecnia 41:636-642. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1590/S1516-35982012000300024">https://doi.org/10.1590/S1516-35982012000300024</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Pascoal</surname>
							<given-names>L. A. F.</given-names>
						</name>
						<name>
							<surname>Thomaz</surname>
							<given-names>M. C.</given-names>
						</name>
						<name>
							<surname>Watanabe</surname>
							<given-names>P. H.</given-names>
						</name>
						<name>
							<surname>Ruiz</surname>
							<given-names>U. S.</given-names>
						</name>
						<name>
							<surname>Ezequiel</surname>
							<given-names>J. M. B.</given-names>
						</name>
						<name>
							<surname>Amorim</surname>
							<given-names>A. B.</given-names>
						</name>
						<name>
							<surname>Daniel</surname>
							<given-names>E.</given-names>
						</name>
						<name>
							<surname>Masson</surname>
							<given-names>G. C. I.</given-names>
						</name>
					</person-group>
					<year>2012</year>
					<article-title>Fiber sources in diets for newly weaned piglets</article-title>
					<source>Revista Brasileira de Zootecnia</source>
					<volume>41</volume>
					<fpage>636</fpage>
					<lpage>642</lpage>
					<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1590/S1516-35982012000300024">https://doi.org/10.1590/S1516-35982012000300024</ext-link>
				</element-citation>
			</ref>
			<ref id="B17">
				<mixed-citation>Pereira, A. M.; Pinna, C.; Biagi, G.; Stefanelli, C.; Maia, M. R. G.; Matos, E.; Segundo, M. A.; Fonseca, A. J. M. and Cabrita, A. R. J. 2020. Supplemental selenium source on gut health: insights on fecal microbiome and fermentation products of growing puppies. FEMS Microbiology Ecology 96:fiaa212. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1093/femsec/fiaa212">https://doi.org/10.1093/femsec/fiaa212</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Pereira</surname>
							<given-names>A. M.</given-names>
						</name>
						<name>
							<surname>Pinna</surname>
							<given-names>C.</given-names>
						</name>
						<name>
							<surname>Biagi</surname>
							<given-names>G.</given-names>
						</name>
						<name>
							<surname>Stefanelli</surname>
							<given-names>C.</given-names>
						</name>
						<name>
							<surname>Maia</surname>
							<given-names>M. R. G.</given-names>
						</name>
						<name>
							<surname>Matos</surname>
							<given-names>E.</given-names>
						</name>
						<name>
							<surname>Segundo</surname>
							<given-names>M. A.</given-names>
						</name>
						<name>
							<surname>Fonseca</surname>
							<given-names>A. J. M.</given-names>
						</name>
						<name>
							<surname>Cabrita</surname>
							<given-names>A. R. J.</given-names>
						</name>
					</person-group>
					<year>2020</year>
					<article-title>Supplemental selenium source on gut health: insights on fecal microbiome and fermentation products of growing puppies</article-title>
					<source>FEMS Microbiology Ecology</source>
					<volume>96</volume>
					<elocation-id>fiaa212</elocation-id>
					<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1093/femsec/fiaa212">https://doi.org/10.1093/femsec/fiaa212</ext-link>
				</element-citation>
			</ref>
			<ref id="B18">
				<mixed-citation>Pluske, J. R.; Hampson, D. J. and Williams, I. H. 1997. Factors influencing the structure and function of the small intestine in the weaned pig: a review. Livestock Production Science 51:215-236. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1016/S0301-6226 (97)00057-2">https://doi.org/10.1016/S0301-6226 (97)00057-2</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Pluske</surname>
							<given-names>J. R.</given-names>
						</name>
						<name>
							<surname>Hampson</surname>
							<given-names>D. J.</given-names>
						</name>
						<name>
							<surname>Williams</surname>
							<given-names>I. H.</given-names>
						</name>
					</person-group>
					<year>1997</year>
					<article-title>Factors influencing the structure and function of the small intestine in the weaned pig: a review</article-title>
					<source>Livestock Production Science</source>
					<volume>51</volume>
					<fpage>215</fpage>
					<lpage>236</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1016/S0301-6226 (97)00057-2">https://doi.org/10.1016/S0301-6226 (97)00057-2</ext-link>
					</comment>
				</element-citation>
			</ref>
			<ref id="B19">
				<mixed-citation>Rao, Z.-X.; Tokach, M. D.; Woodworth, J. C.; DeRouchey, J. M.; Goodband, R. D. and Gebhardt, J. T. 2023. Evaluation of selenium source on nursery pig growth performance, serum and tissue selenium concentrations, and serum antioxidant status. Translational Animal Science 7:txad049. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1093/tas/txad049">https://doi.org/10.1093/tas/txad049</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Rao</surname>
							<given-names>Z.-X.</given-names>
						</name>
						<name>
							<surname>Tokach</surname>
							<given-names>M. D.</given-names>
						</name>
						<name>
							<surname>Woodworth</surname>
							<given-names>J. C.</given-names>
						</name>
						<name>
							<surname>DeRouchey</surname>
							<given-names>J. M.</given-names>
						</name>
						<name>
							<surname>Goodband</surname>
							<given-names>R. D.</given-names>
						</name>
						<name>
							<surname>Gebhardt</surname>
							<given-names>J. T.</given-names>
						</name>
					</person-group>
					<year>2023</year>
					<article-title>Evaluation of selenium source on nursery pig growth performance, serum and tissue selenium concentrations, and serum antioxidant status</article-title>
					<source>Translational Animal Science</source>
					<volume>7</volume>
					<elocation-id>txad049</elocation-id>
					<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1093/tas/txad049">https://doi.org/10.1093/tas/txad049</ext-link>
				</element-citation>
			</ref>
			<ref id="B20">
				<mixed-citation>Rosmini, M. R.; Perlo, F.; Pérez-Alvarez, J. A.; Pagán-Moreno, M. J.; Gago-Gago, A.; López-Santoveña, F. and Aranda-Catalá, V. 1996. TBA test by an extractive method applied to ‘paté.’ Meat Science 42:103-110. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1016/0309-1740">https://doi.org/10.1016/0309-1740</ext-link>(95)00010-0</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Rosmini</surname>
							<given-names>M. R.</given-names>
						</name>
						<name>
							<surname>Perlo</surname>
							<given-names>F.</given-names>
						</name>
						<name>
							<surname>Pérez-Alvarez</surname>
							<given-names>J. A.</given-names>
						</name>
						<name>
							<surname>Pagán-Moreno</surname>
							<given-names>M. J.</given-names>
						</name>
						<name>
							<surname>Gago-Gago</surname>
							<given-names>A.</given-names>
						</name>
						<name>
							<surname>López-Santoveña</surname>
							<given-names>F.</given-names>
						</name>
						<name>
							<surname>Aranda-Catalá</surname>
							<given-names>V.</given-names>
						</name>
					</person-group>
					<year>1996</year>
					<article-title>TBA test by an extractive method applied to ‘paté</article-title>
					<source>Meat Science</source>
					<volume>42</volume>
					<fpage>103</fpage>
					<lpage>110</lpage>
					<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1016/0309-1740">https://doi.org/10.1016/0309-1740</ext-link>
				</element-citation>
			</ref>
			<ref id="B21">
				<mixed-citation>Rostagno, H. S.; Albino, L. F. T.; Donzele, J. L.; Gomes, P. C.; Oliveira, R. F. M.; Lopes, D. C.; Ferreira, A. S.; Barreto, S. L. T. and Euclides, R. F. 2011. Tabelas brasileiras para aves e suínos. 3.ed. UFV, DZO, Viçosa, MG.</mixed-citation>
				<element-citation publication-type="book">
					<person-group person-group-type="author">
						<name>
							<surname>Rostagno</surname>
							<given-names>H. S.</given-names>
						</name>
						<name>
							<surname>Albino</surname>
							<given-names>L. F. T.</given-names>
						</name>
						<name>
							<surname>Donzele</surname>
							<given-names>J. L.</given-names>
						</name>
						<name>
							<surname>Gomes</surname>
							<given-names>P. C.</given-names>
						</name>
						<name>
							<surname>Oliveira</surname>
							<given-names>R. F. M.</given-names>
						</name>
						<name>
							<surname>Lopes</surname>
							<given-names>D. C.</given-names>
						</name>
						<name>
							<surname>Ferreira</surname>
							<given-names>A. S.</given-names>
						</name>
						<name>
							<surname>Barreto</surname>
							<given-names>S. L. T.</given-names>
						</name>
						<name>
							<surname>Euclides</surname>
							<given-names>R. F.</given-names>
						</name>
					</person-group>
					<year>2011</year>
					<source>Tabelas brasileiras para aves e suínos</source>
					<edition>3</edition>
					<publisher-name>UFV, DZO</publisher-name>
					<publisher-loc>Viçosa, MG</publisher-loc>
				</element-citation>
			</ref>
			<ref id="B22">
				<mixed-citation>Rostagno, S. H.; Albino, L. F. T.; Hannas, M. I.; Donzele, J. L.; Sakomura, N. K.; Perazzo, F. G.; Saraiva, A.; Abreu, M. L. T.; Rodrigues, P. B.; Oliveira, R. F. M.; Barreto, S. L. T.; and Brito, C. O. 2017. Tabelas brasileiras para aves e suínos. 4.ed. UFV, DZO, Viçosa, MG.</mixed-citation>
				<element-citation publication-type="book">
					<person-group person-group-type="author">
						<name>
							<surname>Rostagno</surname>
							<given-names>S. H.</given-names>
						</name>
						<name>
							<surname>Albino</surname>
							<given-names>L. F. T.</given-names>
						</name>
						<name>
							<surname>Hannas</surname>
							<given-names>M. I.</given-names>
						</name>
						<name>
							<surname>Donzele</surname>
							<given-names>J. L.</given-names>
						</name>
						<name>
							<surname>Sakomura</surname>
							<given-names>N. K.</given-names>
						</name>
						<name>
							<surname>Perazzo</surname>
							<given-names>F. G.</given-names>
						</name>
						<name>
							<surname>Saraiva</surname>
							<given-names>A.</given-names>
						</name>
						<name>
							<surname>Abreu</surname>
							<given-names>M. L. T.</given-names>
						</name>
						<name>
							<surname>Rodrigues</surname>
							<given-names>P. B.</given-names>
						</name>
						<name>
							<surname>Oliveira</surname>
							<given-names>R. F. M.</given-names>
						</name>
						<name>
							<surname>Barreto</surname>
							<given-names>S. L. T.</given-names>
						</name>
						<name>
							<surname>Brito</surname>
							<given-names>C. O.</given-names>
						</name>
					</person-group>
					<year>2017</year>
					<source>Tabelas brasileiras para aves e suínos</source>
					<edition>4</edition>
					<publisher-name>UFV, DZO</publisher-name>
					<publisher-loc>Viçosa, MG</publisher-loc>
				</element-citation>
			</ref>
			<ref id="B23">
				<mixed-citation>Rotruck, J. T.; Pope, A. L.; Ganther, H. E.; Swanson, A. B.; Hafeman, D. G. and Hoekstra, W. G. 1973. Selenium: Biochemical role as a component of glutathione peroxidase. Science 179:588-590.</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Rotruck</surname>
							<given-names>J. T.</given-names>
						</name>
						<name>
							<surname>Pope</surname>
							<given-names>A. L.</given-names>
						</name>
						<name>
							<surname>Ganther</surname>
							<given-names>H. E.</given-names>
						</name>
						<name>
							<surname>Swanson</surname>
							<given-names>A. B.</given-names>
						</name>
						<name>
							<surname>Hafeman</surname>
							<given-names>D. G.</given-names>
						</name>
						<name>
							<surname>Hoekstra</surname>
							<given-names>W. G.</given-names>
						</name>
					</person-group>
					<year>1973</year>
					<article-title>Selenium: Biochemical role as a component of glutathione peroxidase</article-title>
					<source>Science</source>
					<volume>179</volume>
					<fpage>588</fpage>
					<lpage>590</lpage>
				</element-citation>
			</ref>
			<ref id="B24">
				<mixed-citation>Sakomura, N. K. and Rostagno, H. S. 2016. Métodos de pesquisa em nutrição de monogástricos. 2.ed. Funep, Jaboticabal.</mixed-citation>
				<element-citation publication-type="book">
					<person-group person-group-type="author">
						<name>
							<surname>Sakomura</surname>
							<given-names>N. K.</given-names>
						</name>
						<name>
							<surname>Rostagno</surname>
							<given-names>H. S.</given-names>
						</name>
					</person-group>
					<year>2016</year>
					<source>Métodos de pesquisa em nutrição de monogástricos</source>
					<edition>2</edition>
					<publisher-name>Funep</publisher-name>
					<publisher-loc>Jaboticabal</publisher-loc>
				</element-citation>
			</ref>
			<ref id="B25">
				<mixed-citation>Schomburg, L. and Schweizer, U. 2009. Hierarchical regulation of selenoprotein expression and sex-specific effects of selenium. Biochimica et Biophysica Acta (BBA) - General Subjects 1790:1453-1462. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1016/j.bbagen.2009.03.015">https://doi.org/10.1016/j.bbagen.2009.03.015</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Schomburg</surname>
							<given-names>L.</given-names>
						</name>
						<name>
							<surname>Schweizer</surname>
							<given-names>U.</given-names>
						</name>
					</person-group>
					<year>2009</year>
					<article-title>Hierarchical regulation of selenoprotein expression and sex-specific effects of selenium</article-title>
					<source>Biochimica et Biophysica Acta (BBA) - General Subjects</source>
					<volume>1790</volume>
					<fpage>1453</fpage>
					<lpage>1462</lpage>
					<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1016/j.bbagen.2009.03.015">https://doi.org/10.1016/j.bbagen.2009.03.015</ext-link>
				</element-citation>
			</ref>
			<ref id="B26">
				<mixed-citation>Shen, Y. B.; Piao, X. S.; Kim, S. W.; Wang, L.; Liu, P.; Yoon, I. and Zhen, Y. G. 2009. Effects of yeast culture supplementation on growth performance, intestinal health, and immune response of nursery pigs. Journal of Animal Science 87:2614-2624. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.2527/jas.2008-1512">https://doi.org/10.2527/jas.2008-1512</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Shen</surname>
							<given-names>Y. B.</given-names>
						</name>
						<name>
							<surname>Piao</surname>
							<given-names>X. S.</given-names>
						</name>
						<name>
							<surname>Kim</surname>
							<given-names>S. W.</given-names>
						</name>
						<name>
							<surname>Wang</surname>
							<given-names>L.</given-names>
						</name>
						<name>
							<surname>Liu</surname>
							<given-names>P.</given-names>
						</name>
						<name>
							<surname>Yoon</surname>
							<given-names>I.</given-names>
						</name>
						<name>
							<surname>Zhen</surname>
							<given-names>Y. G.</given-names>
						</name>
					</person-group>
					<year>2009</year>
					<article-title>Effects of yeast culture supplementation on growth performance, intestinal health, and immune response of nursery pigs</article-title>
					<source>Journal of Animal Science</source>
					<volume>87</volume>
					<fpage>2614</fpage>
					<lpage>2624</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.2527/jas.2008-1512">https://doi.org/10.2527/jas.2008-1512</ext-link>
					</comment>
				</element-citation>
			</ref>
			<ref id="B27">
				<mixed-citation>Son, A. R.; Jeong, J.; Park, K. R.; Kim, M.; Lee, S. D.; Yoo, J.-H.; Do, Y.-J.; Reddy, K. E. and Lee, H.-J. 2018. Effects of graded concentrations of supplemental selenium on selenium concentrations in tissues and prediction equations for estimating dietary selenium intake in pigs. PeerJ 6:e5791. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.7717/peerj.5791">https://doi.org/10.7717/peerj.5791</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Son</surname>
							<given-names>A. R.</given-names>
						</name>
						<name>
							<surname>Jeong</surname>
							<given-names>J.</given-names>
						</name>
						<name>
							<surname>Park</surname>
							<given-names>K. R.</given-names>
						</name>
						<name>
							<surname>Kim</surname>
							<given-names>M.</given-names>
						</name>
						<name>
							<surname>Lee</surname>
							<given-names>S. D.</given-names>
						</name>
						<name>
							<surname>Yoo</surname>
							<given-names>J.-H.</given-names>
						</name>
						<name>
							<surname>Do</surname>
							<given-names>Y.-J.</given-names>
						</name>
						<name>
							<surname>Reddy</surname>
							<given-names>K. E.</given-names>
						</name>
						<name>
							<surname>Lee</surname>
							<given-names>H.-J.</given-names>
						</name>
					</person-group>
					<year>2018</year>
					<article-title>Effects of graded concentrations of supplemental selenium on selenium concentrations in tissues and prediction equations for estimating dietary selenium intake in pigs</article-title>
					<source>PeerJ</source>
					<volume>6</volume>
					<elocation-id>e5791</elocation-id>
					<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.7717/peerj.5791">https://doi.org/10.7717/peerj.5791</ext-link>
				</element-citation>
			</ref>
			<ref id="B28">
				<mixed-citation>Tennant, B. C. and Center, S. A. 2008. Hepatic function. p.379-412. In: Clinical biochemistry of domestic animals. Kaneko, J. J.; Harvey, J. W. and Bruss, M. L., eds. 6th ed. Academic Press, San Diego.</mixed-citation>
				<element-citation publication-type="book">
					<person-group person-group-type="author">
						<name>
							<surname>Tennant</surname>
							<given-names>B. C.</given-names>
						</name>
						<name>
							<surname>Center</surname>
							<given-names>S. A.</given-names>
						</name>
					</person-group>
					<year>2008</year>
					<chapter-title>Hepatic function</chapter-title>
					<fpage>379</fpage>
					<lpage>412</lpage>
					<source>Clinical biochemistry of domestic animals</source>
					<person-group person-group-type="editor">
						<name>
							<surname>Kaneko</surname>
							<given-names>J. J.</given-names>
						</name>
						<name>
							<surname>Harvey</surname>
							<given-names>J. W.</given-names>
						</name>
						<name>
							<surname>Bruss</surname>
							<given-names>M. L.</given-names>
						</name>
						<role>eds</role>
					</person-group>
					<edition>6th</edition>
					<publisher-name>Academic Press</publisher-name>
					<publisher-loc>San Diego</publisher-loc>
				</element-citation>
			</ref>
			<ref id="B29">
				<mixed-citation>Terzian, A. C. B.; Zuccari, D. A. P. C.; Pereira, R. S.; Pavam, M. V.; Ruiz, C. M.; Sueiro, F. A. R. and Coelho, J. 2007. Avaliação da caspase-3 e Ki-67 como marcadores prognósticos nas neoplasias mamárias em cadelas. Brazilian Journal of Veterinary Research and Animal Science 44:96-102. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.11606/issn.1678-4456.bjvras.2007.26647">https://doi.org/10.11606/issn.1678-4456.bjvras.2007.26647</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Terzian</surname>
							<given-names>A. C. B.</given-names>
						</name>
						<name>
							<surname>Zuccari</surname>
							<given-names>D. A. P. C.</given-names>
						</name>
						<name>
							<surname>Pereira</surname>
							<given-names>R. S.</given-names>
						</name>
						<name>
							<surname>Pavam</surname>
							<given-names>M. V.</given-names>
						</name>
						<name>
							<surname>Ruiz</surname>
							<given-names>C. M.</given-names>
						</name>
						<name>
							<surname>Sueiro</surname>
							<given-names>F. A. R.</given-names>
						</name>
						<name>
							<surname>Coelho</surname>
							<given-names>J.</given-names>
						</name>
					</person-group>
					<year>2007</year>
					<article-title>Avaliação da caspase-3 e Ki-67 como marcadores prognósticos nas neoplasias mamárias em cadelas</article-title>
					<source>Brazilian Journal of Veterinary Research and Animal Science</source>
					<volume>44</volume>
					<fpage>96</fpage>
					<lpage>102</lpage>
					<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.11606/issn.1678-4456.bjvras.2007.26647">https://doi.org/10.11606/issn.1678-4456.bjvras.2007.26647</ext-link>
				</element-citation>
			</ref>
			<ref id="B30">
				<mixed-citation>Tizard, I. 2019. Imunologia veterinária. 10.ed. Guanabara Koogan, Rio de Janeiro.</mixed-citation>
				<element-citation publication-type="book">
					<person-group person-group-type="author">
						<name>
							<surname>Tizard</surname>
							<given-names>I</given-names>
						</name>
					</person-group>
					<year>2019</year>
					<source>Imunologia veterinária</source>
					<edition>10</edition>
					<publisher-name>Guanabara Koogan</publisher-name>
					<publisher-loc>Rio de Janeiro</publisher-loc>
				</element-citation>
			</ref>
			<ref id="B31">
				<mixed-citation>Wernimont, S. M.; Radosevich, J.; Jackson, M. I.; Ephraim, E.; Badri, D. V.; MacLeay, J. M.; Jewell, D. E. and Suchodolski, J. S. 2020. The effects of nutrition on the gastrointestinal microbiome of cats and dogs: Impact on health and disease. Frontiers in Microbiology 11:1266. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3389/fmicb.2020.01266">https://doi.org/10.3389/fmicb.2020.01266</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Wernimont</surname>
							<given-names>S. M.</given-names>
						</name>
						<name>
							<surname>Radosevich</surname>
							<given-names>J.</given-names>
						</name>
						<name>
							<surname>Jackson</surname>
							<given-names>M. I.</given-names>
						</name>
						<name>
							<surname>Ephraim</surname>
							<given-names>E.</given-names>
						</name>
						<name>
							<surname>Badri</surname>
							<given-names>D. V.</given-names>
						</name>
						<name>
							<surname>MacLeay</surname>
							<given-names>J. M.</given-names>
						</name>
						<name>
							<surname>Jewell</surname>
							<given-names>D. E.</given-names>
						</name>
						<name>
							<surname>Suchodolski</surname>
							<given-names>J. S.</given-names>
						</name>
					</person-group>
					<year>2020</year>
					<article-title>The effects of nutrition on the gastrointestinal microbiome of cats and dogs: Impact on health and disease</article-title>
					<source>Frontiers in Microbiology</source>
					<volume>11</volume>
					<size units="pages">1266</size>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3389/fmicb.2020.01266">https://doi.org/10.3389/fmicb.2020.01266</ext-link>
					</comment>
				</element-citation>
			</ref>
			<ref id="B32">
				<mixed-citation>WHO - World Health Organization. 1996. Trace elements in human nutrition and health. WHO, Geneva.</mixed-citation>
				<element-citation publication-type="report">
					<person-group person-group-type="author">
						<collab>WHO - World Health Organization</collab>
					</person-group>
					<year>1996</year>
					<source>Trace elements in human nutrition and health</source>
					<publisher-name>WHO</publisher-name>
					<publisher-loc>Geneva</publisher-loc>
				</element-citation>
			</ref>
			<ref id="B33">
				<mixed-citation>Yoon, J. H.; Ingale, S. L.; Kim, J. S.; Kim, K. H.; Lee, S. H.; Park, Y. K.; Kwon, I. K. and Chae, B. J. 2012. Effects of dietary supplementation of antimicrobial peptide-A3 on growth performance, nutrient digestibility, intestinal and fecal microflora and intestinal morphology in weanling pigs. Animal Feed Science and Technology 177:98-107. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1016/j.anifeedsci.2012.06.009">https://doi.org/10.1016/j.anifeedsci.2012.06.009</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Yoon</surname>
							<given-names>J. H.</given-names>
						</name>
						<name>
							<surname>Ingale</surname>
							<given-names>S. L.</given-names>
						</name>
						<name>
							<surname>Kim</surname>
							<given-names>J. S.</given-names>
						</name>
						<name>
							<surname>Kim</surname>
							<given-names>K. H.</given-names>
						</name>
						<name>
							<surname>Lee</surname>
							<given-names>S. H.</given-names>
						</name>
						<name>
							<surname>Park</surname>
							<given-names>Y. K.</given-names>
						</name>
						<name>
							<surname>Kwon</surname>
							<given-names>I. K.</given-names>
						</name>
						<name>
							<surname>Chae</surname>
							<given-names>B. J.</given-names>
						</name>
					</person-group>
					<year>2012</year>
					<article-title>Effects of dietary supplementation of antimicrobial peptide-A3 on growth performance, nutrient digestibility, intestinal and fecal microflora and intestinal morphology in weanling pigs</article-title>
					<source>Animal Feed Science and Technology</source>
					<volume>177</volume>
					<fpage>98</fpage>
					<lpage>107</lpage>
					<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1016/j.anifeedsci.2012.06.009">https://doi.org/10.1016/j.anifeedsci.2012.06.009</ext-link>
				</element-citation>
			</ref>
			<ref id="B34">
				<mixed-citation>Zarczynska, K.; Sobiech, P.; Radwinska, J. and Rekawek, W. 2013. Effects of selenium on animal health. Journal of Elementology 18:329-340. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.5601/jelem.2013.18.2.12">https://doi.org/10.5601/jelem.2013.18.2.12</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Zarczynska</surname>
							<given-names>K.</given-names>
						</name>
						<name>
							<surname>Sobiech</surname>
							<given-names>P.</given-names>
						</name>
						<name>
							<surname>Radwinska</surname>
							<given-names>J.</given-names>
						</name>
						<name>
							<surname>Rekawek</surname>
							<given-names>W.</given-names>
						</name>
					</person-group>
					<year>2013</year>
					<article-title>Effects of selenium on animal health</article-title>
					<source>Journal of Elementology</source>
					<volume>18</volume>
					<fpage>329</fpage>
					<lpage>340</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.5601/jelem.2013.18.2.12">https://doi.org/10.5601/jelem.2013.18.2.12</ext-link>
					</comment>
				</element-citation>
			</ref>
			<ref id="B35">
				<mixed-citation>Zhang, K.; Guo, X.; Zhao, Q.; Han, Y.; Zhan, T.; Li, Y.; Tang, C. and Zhang, J. 2020. Development and application of a HPLC-ICP-MS method to determine selenium speciation in muscle of pigs treated with different selenium supplements. Food Chemistry 302:125371. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1016/j.foodchem.2019.125371">https://doi.org/10.1016/j.foodchem.2019.125371</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Zhang</surname>
							<given-names>K.</given-names>
						</name>
						<name>
							<surname>Guo</surname>
							<given-names>X.</given-names>
						</name>
						<name>
							<surname>Zhao</surname>
							<given-names>Q.</given-names>
						</name>
						<name>
							<surname>Han</surname>
							<given-names>Y.</given-names>
						</name>
						<name>
							<surname>Zhan</surname>
							<given-names>T.</given-names>
						</name>
						<name>
							<surname>Li</surname>
							<given-names>Y.</given-names>
						</name>
						<name>
							<surname>Tang</surname>
							<given-names>C.</given-names>
						</name>
						<name>
							<surname>Zhang</surname>
							<given-names>J.</given-names>
						</name>
					</person-group>
					<year>2020</year>
					<article-title>Development and application of a HPLC-ICP-MS method to determine selenium speciation in muscle of pigs treated with different selenium supplements</article-title>
					<source>Food Chemistry</source>
					<volume>302</volume>
					<size units="pages">125371</size>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1016/j.foodchem.2019.125371">https://doi.org/10.1016/j.foodchem.2019.125371</ext-link>
					</comment>
				</element-citation>
			</ref>
			<ref id="B36">
				<mixed-citation>Zoidis, E.; Demiris, N.; Kominakis, A. and Pappas, A. C. 2014. Meta-analysis of selenium accumulation and expression of antioxidant enzymes in chicken tissues. Animal 8:542-554. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1017/S1751731113002395">https://doi.org/10.1017/S1751731113002395</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Zoidis</surname>
							<given-names>E.</given-names>
						</name>
						<name>
							<surname>Demiris</surname>
							<given-names>N.</given-names>
						</name>
						<name>
							<surname>Kominakis</surname>
							<given-names>A.</given-names>
						</name>
						<name>
							<surname>Pappas</surname>
							<given-names>A. C.</given-names>
						</name>
					</person-group>
					<year>2014</year>
					<article-title>Meta-analysis of selenium accumulation and expression of antioxidant enzymes in chicken tissues</article-title>
					<source>Animal</source>
					<volume>8</volume>
					<fpage>542</fpage>
					<lpage>554</lpage>
					<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1017/S1751731113002395">https://doi.org/10.1017/S1751731113002395</ext-link>
				</element-citation>
			</ref>
		</ref-list>
		<fn-group>
			<fn fn-type="other">
				<label>Preprint deposit:</label>
				<p> April 15, 2024 <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.20944/preprints202404.1042.v1">https://doi.org/10.20944/preprints202404.1042.v1</ext-link>
				</p>
			</fn>
			<fn fn-type="data-availability" specific-use="data-available-upon-request">
				<label>Data availability:</label>
				<p> The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.</p>
			</fn>
		</fn-group>
	</back>
</article>