rbz Revista Brasileira de Zootecnia R. Bras. Zootec. 1516-3598 1806-9290 Sociedade Brasileira de Zootecnia 00715 10.37496/rbz5320230105 Non-ruminants Effects of yeast on inflammatory responses in yellow-feathered broilers induced by single and multiple lipopolysaccharide stimulation 0009-0004-5731-6687 Zhang Lijiao Conceptualization Writing – original draft 1 0009-0005-3950-4163 Sun Huixin Data curation 1 0009-0009-6505-0619 Tao Hainan Data curation 1 0009-0002-9809-7594 Ding Yinan Methodology 1 0009-0009-4001-5067 Xue Siming Data curation 1 0009-0009-6985-8236 Fang Yan Conceptualization Formal analysis Writing – review & editing 1 2 * Changchun Normal University Changchun Jilin Province China Changchun Normal University, Changchun, Jilin Province, P. R. China. Sanming University Sanming Fujian Province China Sanming University, Sanming, Fujian Province, P. R. China. xiaohuawu19@126.com

Ines Andretta

Heder José D’Avila Lima

The authors declare no conflict of interest.

 25 11 2024 2024 53 e20230105 5 08 2023 26 04 2024 This is an Open Access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. ABSTRACT

This study investigated the effect of yeast on the growth performance and inflammation of yellow-feathered broilers challenged with lipopolysaccharide (LPS). Four hundred and eighty-one-day-old broilers (BW 38.5±1.01 g) were randomly divided into six treatments with eight replicates of 10 birds each and fed a basal diet with or without 0.025% antibiotics and 0.05 and 0.5% yeast (Saccharomyces cerevisiae, 1.0 × 1010 cfu/g), respectively. Broilers from each replication were intra-abdominally injected with LPS (1.0 mg/kg body weight) or saline at 21, 23, 25, and 27 d of age. Samples were obtained after 3 or 12 h of the first injection (d 21) and the last injection (d 27), respectively. The results showed that LPS stimulation resulted in a significant decrease in productive performance (P<0.01) and a significant decrease in splenic index (P<0.05). Lipopolysaccharide injection caused significant (P<0.01) increase in serum α-AGP in the first hour and haptoglobin in the last 3 h (P<0.01), while other acute phase proteins were not significantly affected. All chickens fed diets supplemented with 0.5% yeast had elevated serum levels of IgA (P = 0.094) and lysozyme (P = 0.067) at 12 h of the first injection compared with those fed antibiotic diets. Lipopolysaccharide injection substantially increased the levels of cytokines in serum. A trend toward decreased levels of IL-10 (P = 0.078), transforming growth factor-beta 1 (P = 0.075), and interferon-gamma (P = 0.061) was observed in the LPS-stimulation × diet interaction. There was an LPS-stimulated × diet interaction (P<0.05) for interleukin-1beta transcript levels in the liver 12 h after repeated LPS injections. Chickens fed diets with 0.05 or 0.5% yeast tended to have higher levels of toll-like receptor 4 (P = 0.074) transcripts in the spleen at 3 h and β-defensin 1 (P = 0.065) transcripts at 12 h compared with those fed diets with antibiotics. The addition of 0.05 or 0.5% yeast alleviated the adverse effects caused by LPS injection, and this study provided a reference for the application of yeast in the broiler industry.

 growth performance inflammation live yeast poultry National Natural Science Foundation of China 31671010 1. Introduction

In the process of livestock and poultry farming, poor feeding environments, such as high-density feeding, immunization, and heat stress, can cause stress reactions in livestock and poultry, which can lead to reduced feed intake (FI) and growth retardation. Of these, immunization stress is more common. Harmful microorganisms, endotoxins in the environment, and antigenic molecules in the feed tend to induce immune stress, which affects the behavior and growth of livestock, reduces growth performance, and causes economic losses (Liu et al., 2015). It has been reported that poultry injected with lipopolysaccharide (LPS) have elevated body temperature, reduced FI, and decreased body weight gain (BWG; Klasing, 2007; Al-Ogaili et al., 2022; Liu et al., 2023b). It was also found that the growth performance of livestock and poultry was related to the dose and time of LPS injection (Takahashi et al., 2000; Wright et al., 2000; Shen et al., 2010).

Antibiotics in feed can relieve immune stress in livestock, but many of the harmful consequences of antibiotics are increasingly being recognized. For example, antibiotics can lead to the development of drug resistance in livestock, residues in animal products, imbalance of intestinal bacterial flora, and environmental pollution, which ultimately threaten the sustainable development of animal husbandry and human health. With the total ban of feed antibiotics in the European Union, China is also gradually restricting the use of antibiotics. Seeking pollution-free and environmentally friendly alternatives to antibiotics, controlling livestock stress through nutritional regulation, and reducing economic losses caused by stress have become the main direction of current research.

Yeast is a facultative anaerobic microorganism, which can provide nutrients for livestock, promote intestinal digestion and absorption, regulate micro-ecological balance, enhance immunity, and ultimately improve animal growth performance (Trckova et al., 2014; Trevisi et al., 2015; Liu et al., 2023a). Lipopolysaccharide, a major component of the endotoxin cell wall of Gram-negative bacteria, induces a series of inflammatory responses and is a typical stress model. Numerous reports have shown that after LPS injection, FI and BWG were reduced, and the expression of inflammatory factors in vivo was also changed (Munyaka et al., 2013; Li et al., 2017). There are many reports on the application of active yeast in animals, but there are few applications in yellow-feathered broilers. Therefore, this study investigated the effect of active yeast on immune stress (LPS injection) and its possible mechanisms with a view to informing its application in the broiler industry.

 2. Material and Methods 2.1. Birds, diets, and experimental design

This study was conducted in Changchun, Jilin, China (125°40ʹ N, 43°91ʹ W). Research on animals was conducted according to the institutional committee on animal use (protocol number 2019006).

A total of 480 yellow-feathered broilers (one-day-old, 38.5±1.01 g) were purchased from Changchun poultry company, and randomly divided into six groups with eight replicates per group and 10 broilers in each replicate. The experimental design was a 3 × 2 analytic factorial arrangement. Primary factors included dietary treatments (broiler basal diets supplemented with antibiotics and 0.05 or 0.5% yeast) and LPS stimulation (broilers injected intraperitoneally with LPS or sterile saline). The basal diets were formulated to meet or exceed the National Research Council (NRC, 1994) nutritional requirements for broilers (Table 1). On days 21, 23, 25, and 27, the LPS stimulation groups were injected with LPS (serotype O55:B5, Sigma Chemical Co., St. Louis, MO) at 1 mg/kg body weight (BW), and the unstimulated group was injected with equal amounts of sterile saline.

Composition and nutrient levers of diets (air-dry basis)
Ingredient (%)  
Corn 66.00
Soybean meal 26.00
Fish meal 2.00
Soybean oil 1.70
Limestone 1.30
Dicalcium phosphate 1.10
Wheat middling and red dog 0.60
NaCl 0.30
1% Premix1 1.00
Total 100.00
Chemical composition (%)2  
Metabolizable energy (MJ/kg) 12.13
Crude protein 21.0
Available P 0.45
Calcium 1.00
Lysine 1.15
Methionine 0.50

1 Provided per kilogram of complete feed: vitamin A, 9,500 IU; vitamin D3, 62.5 μg; vitamin K3, 2.65 mg; vitamin B1, 2 mg; vitamin B2, 6 mg; vitamin B12, 0.025 mg; vitamin E, 30 IU; biotin, 0.0325 mg; folic acid, 1.25 mg; pantothenic, 12 mg; niacin, 50 mg; Cu (CuSO4.5H2O), 8 mg; Zn (ZnO), 75 mg; Fe (FeSO4.7H2O), 80 mg; Mn (MnSO4.H2O), 100 mg; Se (NaSeO3), 0.15 mg; I (KI), 0.35 mg. 2 Nutrient levels were calculated values.

Chicks were raised in three-level battery cages with raised wire floors and housed in an environmentally controlled room maintain at 34 ℃ in the beginning of the experiment and was decreased by 2 ℃ each consecutive week until 24 ℃ through to slaughter. The light program was a 12-h light-dark cycle (light from 06:00 to 18:00 h). All broilers had ad libitum access to feed and water. The feeding trial lasted for 28 days. Mortality was recorded on a daily basis, and BWG, FI, and feed conversion ratio (FCR) were calculated.

 2.2. Sample collection and procedure

On days 21 and 27, one broiler was randomly selected from each replicate 3 and 12 h after LPS injection, and wing venous blood samples were collected. Blood samples were kept at room temperature for 2 h, and then centrifuged at 3000 rpm for 15 min to separate the serum. Serum samples were frozen at −80 ℃ until analysis. One broiler was randomly selected in each replicate 3 and 12 h after injection on day 27, and the liver and spleen were removed and weighed at 10 g after slaughtering, rapidly frozen with liquid nitrogen, and stored at −80 °C for mRNA determination.

 2.3. Serum parameters measurement

The level of inflammatory cytokines interleukin-1beta (IL-1β), interleukin-2 (IL-2), interleukin-4 (IL-4), interleukin-6 (IL-6), interleukin-10 (IL-10), interferon-gamma (IFN-γ), tumor necrosis factor-alfa (TFN-α), and transforming growth factor-beta 1 (TGF-β1), C-reactive protein (CRP), haptoglobin (HP), alfa-acid glycoprotein (α-AGP), serum amyloid A protein (SAA), and alfa1-antitrypsin (AAT) levels in serum were measured using ELISA commercial kits (Cusabio Biotech co., Ltd, Wuhan, China) according to the manufacturer’s instructions. Levels of immunoglobulin G, A, and M (IgG, IgA, and IgM, respectively) and lysozyme activity in serum were determined by ELISA commercial kits (Jiancheng Biotechnology Institute, Nanjing, China) according to the manufacturer’s instructions.

 2.4. Quantification of mRNA expression by real-time PCR

Total RNA from the spleen and liver sample was extracted using Trizol Reagent (Invitrogen Life Technologies Co., Carlsbad, CA, USA) according to the manufacturer’s protocol. Total RNA concentration was quantified by the NanoDrop® ND-1000 spectrophotometer (Thermo Scientific, Wilmington, DE, USA), and the integrity was assessed by formaldehyde-agarose gel electrophoresis. After determining the RNA concentration, total RNA (1 μg) was reverse-transcribed into cDNA by a Revert Aid First Strand cDNA Synthesis Kit (Thermo Scientific, Wilmington, DE, USA) according to the manufacturer’s instructions. The cDNA samples were stored at −20 ℃ until analyzed. Quantitative real-time PCR was performed on an Applied Biosystems 7500 Real-Time PCR System (Foster City, CA, USA) using a Roche FastStart Universal SYBR Green Master (Rox) (Roche Co., America). A reaction system of 20 μL included 2.5 μL of cDNA, 1 μL of each primer (10 uM) (Table 2), 12.5 μL of SYBR Green Master (Rox) (2X), and 8 μL of double distilled water. The PCR cycle conditions were set as follows: 95 ℃ for 5 min; 40 cycles of 95 ℃ for 5 s, 60 ℃ for 34 s, 72 ℃ for 30 s, and 72 ℃ for 5 min. All the samples were analyzed in triplicate, and negative controls were included to check for the nonspecific amplification of primers. The melting profile of each sample was analyzed after every PCR run to confirm PCR product specificity. The relative expression levels of targeted genes were calculated according to 2Ct method (Livak and Schmittgen, 2001).

Sequence of real-time PCR primer
Gene Primer sequence (5’-3’) Accession number Product size
β-actin F: GAGAAATTGTGCGTGACATCA NM_205518.1 112
R: CCTGAACCTCTCATTGCCA
IL-1β F: AAGCCTCGCCTGGATTCTGA NM_204524.1 260
R: AAGGACTGTGAGCGGGTGTAG
IL-2 F: ATGGAGCATCTCTATCATCAGCA AF000631.1 169
R: GTAACCACTTCTCCCAGGTAACAC
IL-4 F: GTGCCCACGCTGTGCTTACA GU119892.1 96
R: GTTCATCTTGACGCAGGAAACCT
IL-6 F: AAATCCCTCCTCGCCAATCT NM_204628.1 104
R: CTCACGGTCTTCTCCATAAACG
IL-10 F: TCAATCCAGGGACGATGAACTTA NM_001004414.2 233
R: AGGTGAAGAAGCGGTGACAGC
TNF-α F: GGAATGAACCCTCCGCAGTA AY765397.1 258
R: CAGAGCATCAACGCAAAAGG
IFN-γ F: ATCATACTGAGCCAGATTGTTTCG AJ634956.1 125
R: ACGCCATCAGGAAGGTTGTT
TGF-β1 F: CGGGACGGATGAGAAGAACTG JQ423909.1 303
R: CAGGCACGGACCACCATATTG
TLR-2 F: AAGGAAACTTTGAGGGCATTGT NM_001161650.1 89
R: CGATTTCAGACTTCCAGGCTC
TLR-4 F: TTTGAAAATGTAAGGCGGCTC NM_001030693.1 224
R: ATTTCCAGGGCTGAGTCCGA
HSP-70 F: TGCAAGCAGCTATCCTCATGG NM_001006685.1, FJ217667.1 140
R: GGGAATGGTGGTGTTACGCT
β-defensin 1 F: GCTCATCCCCTTCTTCCTCTTGT NM_204650.2 88
  R: CCCAACACGACAGAATCCTCCT

IL - interleukin; TNF-α - tumor necrosis factor-alfa; IFN-γ - interferon-gamma; TGF-β1- transforming growth factor-beta 1; TLR - toll-like receptor; HSP-70 - heat-shock protein 70; F - forward primer; R - reverse primer.

 2.5. Statistical analysis

Data were analyzed by two-way ANOVA using the GKM procedure of SPSS 17.0 (SPSS Inc., Chicago, IL) as a 3 × 2 factorial arrangement with diet and LPS as main effects. When the P-values of the interaction of main effects was less than 0.10, one-way ANOVA was performed using Duncan multiple comparisons. The statistical model was as follows:

Y i j = μ + β i + ε i j

in which Yij = dependent variable, μ = variable mean, βi = fixed effect of i–th broilers of the treatment, and εij = experimental error associated with observation Yij. Significance was defined as P<0.05 and 0.05 < P<0.10 as a trend. All data are expressed as mean and standard error of the mean (SEM).

 3. Results 3.1. Growth performance

Compared with the antibiotic control group, the addition of yeast to the diet significantly increased ADG and ADFI (P<0.01), but no effect on FCR (P>0.05) during the early stage (1~21 d) (Figure 1). Lipopolysaccharide stimulation decreased ADG and ADFI and increased FCR in broilers from 21 to 28 d of age (P<0.01). The interaction between LPS stimulation and diet had a tendency to improve FCR in broilers (P = 0.084) (Figure 2).

Effect of yeast on the growth performance of broilers at 1 to 21 d of age. ADG - average daily weight gain; ADFI - average daily feed intake; FCR - feed conversion ratio. 0.05% yeast and 0.5% yeast = control supplemented with 0.05 or 0.5% yeast per kg of diet. ** Within each figure, the asterisk means that the difference is significant (P<0.01). No symbols in the figure indicate that the difference is not significant (P>0.05).

Effect of yeast on the growth performance of broilers from 21 to 28 d of age. Lipopolysaccharide (LPS) was intra-abdominally injected at 1 mg/kg body weight or the same amount of saline at 21, 23, 25, and 27 d of age. − mean injected with the saline; + mean injected with LPS. 0.05 and 0.5% yeast = control supplemented with 0.05 or 0.5% yeast per kg of diet. ** Within each figure, the asterisk means that the difference is significant (P<0.01). “→” Within each figure, the arrow means that there is a trend (P = 0.084). No symbols in the figure indicate that the difference is not significant (P>0.05).

3.2. Relative weight of the spleen and liver

There was no interaction effect between LPS stimulation and diet on liver index and spleen index in broilers (Figures 3 and 4). Broiler spleen index decreased significantly (P<0.05) after LPS stimulation on day 27 at 3 and 12 h. Neither LPS nor diet had an effect on liver index.

Effect of yeast on the organ index of broilers after lipopolysaccharide (LPS) injection1 on d 21 (n = 8). 1 Lipopolysaccharide (LPS) was intra-abdominally injected at 1 mg/kg body weight or the same amount of saline at 21 d of age. − mean injected with the saline; + mean injected with LPS. 0.05 and 0.5% yeast = control supplemented with 0.05 or 0.5% yeast per kg of diet. ** Within each figure, the asterisk means that the difference is significant (P<0.01). No symbols in the figure indicate that the difference is not significant (P>0.05).

Effect of yeast on the organ index of broilers after lipopolysaccharide (LPS) injection1 on d 27 (n = 8). 1 Lipopolysaccharide (LPS) was intra-abdominally injected at 1 mg/kg body weight or the same amount of saline at 21, 23, 25, and 27 d of age. − mean injected with the saline; + mean injected with LPS. 0.05 and 0.5% yeast = control supplemented with 0.05 or 0.5% yeast per kg of diet. * Within each figure, the asterisk means that the difference is significant (P<0.05). No symbols in the figure indicate that the difference is not significant (P>0.05).

3.3. Acute-phase proteins and immune globulin

The levels of α-AGP at 3~12 h of the first time and 3 h of the final time, and the levels of HP at 3 h of the final time in serum were increased significantly (P<0.01) by LPS injection (Figures 5 and 6). All chickens fed diets supplemented with 0.5% yeast tended to have higher CRP levels at first LPS injection (P = 0.086, P = 0.091) compared with those fed diets with antibiotic. No significant changes in other serum acute-phase proteins were observed as a result of LPS stimulation. There was no interaction between LPS stimulation and diet on serum acute-phase protein levels (Figure 5).

Effect of yeast on the levels of serum acute-phase protein of broilers after lipopolysaccharide (LPS) injection1 at 3 and 12 h of d 21 (n = 8). AGP - acid glycoprotein; SAA - serum amyloid A protein; CRP - C-reactive protein; AAT - α1-antitrypsin; HP - haptoglobin. 1 Lipopolysaccharide (LPS) was intra-abdominally injected at 1 mg/kg body weight or the same amount of saline at 21 d of age. − mean injected with the saline; + mean injected with LPS. 0.05 and 0.5% yeast = control supplemented with 0.05 or 0.5% yeast per kg of diet. ** Within each figure, the asterisk means that the difference is significant (P<0.01). “→” Within each figure, the arrow means that there is a trend (P = 0.086, P = 0.091). No symbols in the figure indicate that the difference is not significant (P>0.05).

Effect of yeast on the levels of serum acute-phase protein of broilers after lipopolysaccharide (LPS) injection1 at 3 and 12 h of d 27 (n = 8). AGP - acid glycoprotein; SAA - serum amyloid A protein; CRP - C-reactive protein; AAT - α1-antitrypsin; HP - haptoglobin. 1 Lipopolysaccharide (LPS) was intra-abdominally injected at 1 mg/kg body weight or the same amount of saline at 21, 23, 25, and 27 d of age. − mean injected with the saline; + mean injected with LPS. 0.05 and 0.5% yeast = control supplemented with 0.05 or 0.5% yeast per kg of diet. ** Within each figure, the asterisk means that the difference is significant (P<0.01). “→” Within each figure, the arrow means that there is a trend (P = 0.077). No symbols in the figure indicate that the difference is not significant (P>0.05).

There was no interaction effect between LPS stimulation and diets on serum immunoglobulin and lysozyme levels at 3 and 12 h on 21 and 27 d after LPS stimulation (P>0.05), but there was a tendency for IgM (P = 0.052) to decrease at 3 h on 27 d after injection and of lysozyme to increase (P = 0.092) at 12 h on 27 d after injection (Table 3). Serum IgG and IgM levels decreased significantly after LPS stimulation (P<0.01), and lysozyme levels increased significantly 3 h after the first injection (P<0.01), and IgG levels decreased significantly 12 h after the first injection (P<0.01). All chickens fed diets supplemented with 0.5% yeast had higher serum levels of IgA (P = 0.094) and lysozyme (P = 0.067) at 12 h after the first injection compared with chickens fed antibiotic diets (Table 3).

Effect of yeast on the levels of serum immunoglobulin and lysozyme of broilers after lipopolysaccharide (LPS) injection1
Item Antibiotic 0.05% yeast 0.5% yeast SEM P-value
LPS/Saline - + - + - + Diet LPS Interaction
First 3 h IgG (mg/mL) 2.44 1.20 2.02 1.12 1.99 1.05 0.11 0.192 <0.001 0.569
IgM (μg/mL) 351.03 249.62 330.32 275.33 326.23 244.27 8.53 0.404 <0.001 0.307
IgA (mg/mL) 3.99 3.43 3.36 3.87 3.23 3.44 0.10 0.258 0.788 0.100
Lysozyme (U/mL) 179.82 194.22 157.59 171.99 154.66 193.62 4.82 0.141 0.016 0.434
12 h IgG (mg/mL) 2.43 1.22 1.90 1.04 1.75 1.48 0.12 0.362 <0.001 0.185
IgM (μg/mL) 355.35 398.86 354.82 376.04 326.10 348.87 8.77 0.173 0.097 0.837
IgA (mg/mL) 3.99 3.14 2.56 2.98 3.31 3.36 0.15 0.094 0.669 0.212
Lysozyme (U/mL) 189.82 206.05 207.59 216.59 200.66 200.23 2.69 0.067 0.114 0.416
Final 3 h IgG (mg/mL) 2.52 1.98 1.64 2.25 1.41 1.95 0.16 0.367 0.52 0.280
IgM (μg/mL) 363.83 328.09 315.68 342.06 339.31 324.11 5.37 0.354 0.429 0.052
IgA (mg/mL) 2.04 1.74 1.82 2.14 2.17 2.24 0.07 0.148 0.836 0.159
Lysozyme (U/mL) 155.29 166.27 153.36 154.6 145.6 160.70 3.68 0.713 0.196 0.849
12 h IgG (mg/mL) 1.74 2.36 1.68 1.72 1.68 2.15 0.19 0.614 0.203 0.705
IgM (μg/mL) 362.58 323.54 341.93 364.21 339.31 381.78 8.17 0.683 0.602 0.118
IgA (mg/mL) 2.16 1.93 1.8 2.06 2.24 1.97 0.06 0.47 0.483 0.122
Lysozyme (U/mL) 182.69 192.17 185.12 172.5 167.02 192.05 6.87 0.545 0.298 0.092

IgG - immunoglobulin G; IgM - immunoglobulin M; IgA - immunoglobulin A; −: injected with the saline; +: injected with LPS. 1 Lipopolysaccharide was intra-abdominally injected at 1 mg/kg BW or the same amount of saline at 21, 23, 25, and 27 d of age.

 3.4. Serum cytokines and mRNA expression associated with inflammatory factors

For the expression analysis of all immune target genes, compared with the antibiotic control group, there was a trend toward lower IFN-γ (P = 0.092) 3 h after first injection and a trend toward higher IL-4 (P = 0.095), IL-10 (P = 0.084), IFN-γ (P = 0.097), and TGF-β (P = 0.086) 12 h after first injection. Lipopolysaccharide injection greatly increased serum cytokine levels. At the time of the first injection, all chickens fed diets supplemented with 0.5% yeast showed a significant decrease in TGF-β levels at 3 h (P<0.05), a trend toward higher levels of IL-1β at 3 h (P = 0.085), and a trend toward higher levels of TGF-β at 12 h (P = 0.065), as compared with chickens fed diets with antibiotic (Table 4).

Effect of yeast on the levels of serum cytokines of broilers after lipopolysaccharide (LPS) injection1
Item Antibiotic 0.05% yeast 0.5% yeast SEM P-value
LPS/Saline - + - + - + Diet LPS Interaction
First 3 h IL-1β 20.17 21.19 20.91 21.48 20.91 24.62 0.43 0.085 0.03 0.197
IL-2 2.11 2.36 2.13 2.45 2.14 2.30 0.04 0.742 0.004 0.707
IL-4 11.82 54.33 11.07 57.08 11.38 48.59 3.82 0.685 <0.001 0.671
IL-6 20.12 64.49 19.31 68.95 19.51 60.24 3.77 0.498 <0.001 0.477
IL-10 2.08 2.57 1.95 2.54 2.21 2.57 0.09 0.802 0.009 0.867
TNF-α 60.07 56.65 59.27 72.15 38.71 69.88 4.02 0.482 0.092 0.188
IFN-γ 59.65 41.72 43.98 50.27 61.38 43.83 2.57 0.651 0.052 0.092
TGF-β 0.42 1.73 0.48 2.13 0.39 1.23 0.13 0.035 <0.001 0.105
12 h IL-1β 20.07 23.83 19.12 24.53 20.94 25.03 0.51 0.431 <0.001 0.672
IL-2 1.89 2.06 1.65 1.90 1.56 2.26 0.09 0.651 0.044 0.445
IL-4 12.50 33.09 11.31 43.04 11.38 36.25 2.22 0.204 <0.001 0.095
IL-6 20.12 38.49 19.31 63.75 19.51 59.78 3.78 0.136 <0.001 0.106
IL-10 2.38 2.45 2.55 2.66 2.43 2.47 0.08 0.659 0.673 0.982
TNF-α 54.29 57.85 50.52 60.9 48.01 57.74 0.92 0.122 <0.001 0.084
IFN-γ 42.46 51.61 45.67 48.93 45.32 54.41 0.85 0.125 <0.001 0.097
TGF-β 0.43 0.99 0.44 1.72 0.49 2.95 0.21 0.065 <0.001 0.086
Final 3 h IL-1β 19.37 26.35 19.95 24.31 20.42 25.7 0.52 0.433 <0.001 0.233
IL-2 1.84 2.05 2.07 1.70 1.62 1.91 0.09 0.706 0.831 0.305
IL-4 11.5 13.39 14.48 13.32 15.3 13.45 0.88 0.198 0.016 0.173
IL-6 18.74 20.71 19.21 19.89 19.20 20.26 0.21 0.912 0.003 0.391
IL-10 2.23 2.58 2.25 2.17 2.76 2.08 0.09 0.587 0.442 0.078
TNF-α 52.96 55.78 52.11 55.49 50.03 52.63 0.77 0.250 0.061 0.977
IFN-γ 35.97 38.16 45.95 65.18 52.83 52.5 3.47 0.070 0.302 0.434
TGF-β 0.33 0.33 0.36 0.26 0.33 0.32 0.01 0.672 0.103 0.075
12 h IL-1β 19.09 20.29 20.48 19.96 21.26 20.45 0.25 0.163 0.932 0.210
IL-2 2.22 1.7 2.28 2.04 1.75 2.19 0.10 0.622 0.568 0.114
IL-4 11.00 12.71 12.73 11.73 13.31 12.9 0.45 0.436 0.903 0.368
IL-6 15.79 16.79 15.03 15.05 15.19 16.47 0.47 0.571 0.442 0.857
IL-10 3.79 7.88 2.98 3.40 2.83 3.89 0.29 0.053 0.061 0.260
TNF-α 39.95 39.68 64.60 73.21 56.95 83.28 5.65 0.047 0.295 0.601
IFN-γ 31.67 49.53 46.18 39.86 55.04 38.53 3.00 0.689 0.779 0.061
TGF-β 0.37 0.41 0.39 0.41 0.38 0.37 0.01 0.651 0.438 0.617

IL - interleukin; TNF-α - tumor necrosis factor-alfa; IFN-γ - interferon-gamma; TGF-β - transforming growth factor beta; −: injected with the saline; +: injected with LPS. 1 Lipopolysaccharide was intra-abdominally injected at 1 mg/kg BW or the same amount of saline at 21, 23, 25, and 27 d of age.

There was an interaction between LPS stimulation and diets, which had a tendency to reduce IL-10 (P = 0.078), TGF-β (P = 0.075), and IFN-γ (P = 0.061) levels at 27 d. Multiple injections of LPS significantly increased serum levels of IL-1β, IL-4, and IL-6 (P<0.05) at 3 h compared with saline-injected chickens. Compared to the diet with antibiotic, diets supplemented with 0.05 or 0.5% yeast significantly increased TFN-α levels (P<0.05) at 12 h and tended to increase IFN-γ (P = 0.070) and decrease IL-10 (P = 0.053) at 3 h (Table 4).

 3.5. mRNA expression related to inflammatory factors in liver and spleen

At 12 h after LPS stimulation, there was a significant interaction (P<0.05) between diet and immune challenge on IL-1β transcript levels in the liver (Table 5). In LPS-injected chickens, the diet supplemented with 0.5% yeast significantly decreased IL-1β transcript levels at 3 h (P<0.05) and had a tendency to increase TGF-β transcript levels (P = 0.077) and decrease IL-10 transcript levels at 3 h (P = 0.076), compared with the diet with antibiotic. Compared with saline injection, LPS stimulation significantly increased the transcript levels of IL-1β, IL-2, IL-4, TNF-α, and TGF-β at 3 h and 12 h, as well as IFN-γ at 3 h after repeated injections in chicken livers (P<0.05).

Effect of yeast on the expression of mRNA related to inflammatory factors in liver and spleen of broilers after repeated lipopolysaccharide (LPS) injection1
Item Antibiotic 0.05% yeast 0.5% yeast SEM P-value
LPS/Saline - + - + - + Diet LPS Interaction
Liver 3 h IL-1β 1.00 36.46 2.67 35.88 5.06 33.60 14.04 0.953 <0.001 0.289
IL-2 1.00 15.28 2.98 25.01 1.41 20.75 3.23 0.085 <0.001 0.271
IL-4 1.00 11.90 1.02 11.30 0.63 12.32 5.51 0.959 <0.001 0.834
IL-6 1.00 7.19 2.68 3.10 1.27 2.72 2.89 0.550 0.106 0.298
IL-10 1.00 3.97 2.40 1.48 0.92 2.55 0.49 0.819 0.239 0.302
TNF-α 1.00 9.08 1.97 13.53 2.43 7.48 1.64 0.243 <0.001 0.229
IFN-γ 1.00 2.06 0.78 1.69 0.87 2.38 0.59 0.440 0.001 0.606
TGF-β 1.00 0.53 0.05 3.13 1.20 3.47 0.22 0.144 0.019 0.077
12 h IL-1β 1.00d 18.19a 2.67cd 15.27ab 4.93c 13.11b 5.79 0.851 <0.001 0.010
IL-2 1.00 12.22 3.15 14.35 1.54 14.98 1.69 0.243 <0.001 0.603
IL-4 1.00 10.21 1.64 8.99 1.17 7.59 4.08 0.587 <0.001 0.514
IL-6 1.00 7.24 0.33 4.42 0.71 6.60 2.67 0.158 <0.001 0.437
IL-10 1.00 3.71 2.18 0.43 0.95 1.39 0.39 0.371 0.525 0.076
TNF-α 1.00 6.20 1.96 3.09 2.40 4.05 0.80 0.714 0.029 0.277
IFN-γ 1.00 0.33 0.33 0.72 0.84 0.84 0.43 0.641 0.735 0.303
TGF-β 1.00 2.96 0.04 2.80 1.51 2.22 0.14 0.509 <0.001 0.157
Spleen 3 h IL-1β 1.00 6.15 1.11 2.86 1.57 4.42 0.89 0.142 <0.001 0.108
IL-2 1.00 1.54 3.15 1.05 1.82 0.87 0.14 0.78 0.896 0.683
IL-4 1.00 1.04 1.17 1.59 1.22 1.70 0.14 0.231 0.160 0.656
IL-6 1.00 3.51 1.73 3.49 1.42 3.09 0.35 0.754 0.001 0.669
IL-10 1.00 831 1.17 9.10 1.29 8.99 1.47 0.281 0.005 0.171
TNF-α 1.00 25.79 2.96 20.46 3.16 23.38 1.83 0.95 0.001 0.826
IFN-γ 1.00 13.27 0.32 9.22 0.42 7.80 11.89 0.572 0.002 0.703
TGF-β 1.00 2.36 0.86 2.15 0.79 2.01 0.58 0.913 0.032 0.995
12 h IL-1β 1.00 2.60 1.51 3.89 2.11 3.06 0.38 0.295 0.005 0.503
IL-2 1.00 4.58 2.43 2.45 2.73 2.72 0.28 0.946 0.215 0.220
IL-4 1.00 1.85 0.98 6.25 4.17 3.13 0.45 0.579 0.400 0.426
IL-6 1.00 1.27 1.13 1.32 0.98 1.37 0.43 0.981 0.467 0.976
IL-10 1.00 1.64 1.56 1.42 1.58 1.52 0.15 0.806 0.619 0.499
TNF-α 1.00 23.88 2.96 22.27 3.39 25.93 1.73 0.873 <0.001 0.917
IFN-γ 1.00 15.58 3.53 10.42 2.30 13.58 2.23 0.864 <0.001 0.340
TGF-β 1.00 1.52 0.88 0.91 1.29 1.60 0.15 0.155 0.216 0.654

IL - interleukin; TNF-α - tumor necrosis factor-alfa; IFN-γ - interferon-gamma; TGF-β - transforming growth factor beta; −: injected with the saline; +: injected with LPS. 1 Lipopolysaccharide was intra-abdominally injected at 1 mg/kg BW or the same amount of saline at 21, 23, 25, and 27 d of age.

There was no interaction effect between diets and LPS stimulation on the expression of mRNA related to inflammatory factors in spleen (Table 5). Compared with saline injection, LPS stimulation significantly increased the levels of IL-1β, IL-2, IL-4, TNF-α, and TGF-β transcripts in the liver at 3 and 12 h, as well as the levels of IFN-γ transcripts at 3 h after repeated injections, and significantly increased the levels of IL-1β, TNF-α, and IFN-γ transcripts in the spleen at 3 and 12 h, as well as the levels of IL-6, IL-10, and TGF-β transcripts at 3 h after repeated injections. Lipopolysaccharide stimulation significantly increased the levels of IL-6, IL-10, and TGF-β transcript levels in the spleen at 3 h after repeated injections (P<0.05). There were no differences (P>0.05) in cytokine levels in the livers and spleens of chickens fed diets supplemented with 0.05 or 0.5% yeast compared with LPS-injected chickens fed antibiotic diets.

Lipopolysaccharide increased the expression of TLR-2, TLR-4, and β-defensin 1 in the liver at 3 h (P<0.05), and there was a trend to increase the level of TLR-4 transcripts at 12 h (P = 0.093). There was no interaction between LPS stimulation and diet on the expression of inflammatory factor-associated mRNAs in the liver (Table 6).

Effect of yeast on the expression of mRNA related to inflammatory factors in liver and spleen of broilers after repeated lipopolysaccharide (LPS) injection1
Item Antibiotic 0.05% yeast 0.5% yeast SEM P-value
LPS/Saline - + - + - + Diet LPS Interaction
Liver 3 h HSP70 1.00 8.24 2.53 2.61 1.05 2.27 1.47 0.412 0.142 0.246
TLR-2 1.00 5.65 1.51 4.75 1.25 2.68 1.82 0.437 0.005 0.373
TLR-4 1.00 2.30 1.07 2.99 1.03 4.20 1.03 0.474 0.005 0.485
β-defensin 1 1.00 2.27 1.62 2.02 1.72 1.85 0.16 0.776 0.020 0.136
12 h HSP70 1.00 1.69 2.95 0.96 1.16 0.68 0.44 0.464 0.394 0.294
TLR-2 1.00 2.54 4.08 0.35 1.38 0.19 1.46 0.505 0.277 0.136
TLR-4 1.00 2.09 1.43 2.36 1.31 1.82 0.47 0.790 0.093 0.871
β-defensin 1 1.00 3.62 0.82 2.27 0.62 1.18 0.56 0.515 0.137 0.689
Spleen 3 h HSP70 1.00 3.30 0.10 1.85 0.12 3.09 0.4 0.304 0.002 0.704
TLR-2 1.00 5.43 0.17 4.44 0.17 5.36 0.89 0.779 0.001 0.928
TLR-4 1.00 3.79 1.74 9.06 5.73 7.03 0.69 0.074 0.014 0.198
β-defensin 1 1.00 3.29 0.34 2.97 1.03 5.47 0.40 0.230 0.001 0.453
12 h HSP70 1.00 0.54 0.10 0.47 0.12 0.56 0.12 0.184 0.604 0.225
TLR-2 1.00 1.04 0.17 0.80 0.17 1.32 0.25 0.582 0.167 0.560
TLR-4 1.00 3.29 1.09 4.49 2.29 3.54 0.60 0.619 0.005 0.449
β-defensin 1 1.00 1.68 0.44 1.79 1.19 2.86 0.18 0.065 0.001 0.394

HSP70 - heat-shock protein 70; TLR - toll-like receptor; −: injected with the saline; +: injected with LPS. 1 Lipopolysaccharide was intra-abdominally injected at 1 mg/kg BW or the same amount of saline at 21, 23, 25, and 27 d of age.

HSP70, TLR-2, TLR-4, and β-defensin 1 transcript levels were significantly increased at 3 h and TLR-4 and β-defensin 1 transcript levels were significantly increased at 12 h after LPS stimulation. Chickens fed 0.05 or 0.5% yeast tended to have higher transcript levels of TLR4 (P = 0.074) at 3 h and β-defensin 1 (P = 0.065) at 12 h in spleens compared with chickens fed the antibiotic diet. There was no interaction between LPS stimulation and diet on the expression of inflammatory factor-associated mRNAs in spleens (Table 6).

 4. Discussion

The present study was designed to investigate whether the addition of 0.05 or 0.5% live yeast to the diet affects growth performance, organ weights, and inflammatory immune activity when the organisms are in a state of immune stress or in a normal physiological state. The results of this paper showed a significant increase in BWG and FI in chickens fed diets supplemented with 0.05 or 0.5% yeast compared with chickens fed antibiotics for the first three weeks, which is similar to previously described results (Kompiang, 2002; Bai et al., 2013). The improved performance of broiler chickens may be related to the fact that yeast enters the gut and remains active. On the one hand, yeast is rich in nutrients such as proteins, minerals, and vitamins, and the yeast cell wall can absorb mycotoxins and pathogens to protect intestinal health. On the other hand, protease and amylase are the products of yeast metabolism, which can effectively help the intestinal tract to degrade nutrients and promote nutrient absorption. Meanwhile, yeast contains some unknown growth factors that can promote the growth of intestinal bacteria and improve the nutritional metabolism of animals. After injection of LPS, FI and body weight gain were reduced and FCR was increased in the fourth week compared with the control group, similar to the previous results (Virden et al., 2007; Yang et al., 2011; Feng et al., 2012). There were no significant differences in the effects of adding 0.05 or 0.5% yeast on FI, body weight gain, and FCR of yellow-feathered broilers compared with antibiotics. This indicates that yeast and antibiotics had similar effects on the performance of yellow-feathered broilers after LPS stimulation, but there was no interaction between diet type and immune stress. These results suggest that the addition of yeast can play an important role in the nutritional modulation of immune stress to alleviate it.

The liver has metabolic and immune functions, and the spleen is the largest peripheral immune organ in broilers, participating in systemic cellular and humoral immunity (Pozo et al., 2009). It is generally accepted that the relative weights of immune organs in domestic animals reflect the strength of immune function, but the weights and indices of immune organs in broiler chickens as a measure of immune function are not clearly defined (Cai et al., 2022). In the present study, there was no significant difference in liver indices by LPS stimulation, but spleen indices were significantly decreased, which is consistent with the results in weaned piglets (Li et al., 2022) and quail (Yu et al., 2017). Matur et al. (2010) also reported that the addition of yeast extract had no effect on liver index in hen diet. It was also found that there was no significant difference in liver index and spleen index between LPS-stimulated and non-LPS-stimulated chickens with or without the addition of yeast, which may be related to the amount of yeast added and broiler diet, or the effect of yeast on liver and spleen has not yet been shown on the organ lever.

Acute-phase proteins such as CRP, HP, SAA, α-AGP, and AAT are transiently altered in animal serum when stimulated by trauma, inflammation, or infection, and their potential application in animal health status is of great importance (Cray et al., 2009). This study showed that LPS stress increased the level of serum α-AGP at 3 and 12 h after the initial injection, which was similar to that of many scholars on livestock and poultry (Han et al., 2014; Li et al., 2018). The α-AGP is synthesized in the liver, is mediated by IL-1β, IL-6, and TNF-α (Drazan et al., 1996), and is an anti-inflammatory factor that inhibits the activity of neutrophils and natural killer cells. In addition, α-AGP binds and transports substances such as histamine and steroids, enhancing LPS clearance or neutralizing its toxicity by binding directly to LPS (Waititu et al., 2016). In this study, there was no significant change in serum CRP detected after LPS injection, which may be related to sampling time or LPS dose. C-reactive protein is one of the earliest changes in acute-phase response protein. The peak of CRP in serum appeared at 1 and 24 h after stress, while the two sampling times of the present test were not included at this period, so it may be the reason why no significant changes of CRP was detected. Compared with chickens fed antibiotic diets, all chickens fed diets supplemented with 0.05 or 0.5% yeast had higher CRP levels at the time of the first LPS injection, and all chickens fed diets supplemented with 0.05% yeast had higher CRP levels at the time of the last 12 h of LPS injection. The effect of adding 0.5% yeast was consistent with that of antibiotics for many hours after LPS injection. The results showed that yeast had no significant effect on serum acute-phase protein levels in broilers in the absence of stress and in the presence of LPS stress, similar to the antibiotic group. Humoral immunity is an important aspect of animal specific immunity, which is mainly realized through immunoglobulin levels and specific antibody levels. In this study, we found that after the first injection of LPS, serum IgG and IgM levels of piglets decreased significantly at 3 h. Serum IgG level also decreased significantly, which was consistent with the results of the study on weaned piglets (Wang et al., 2019). However, serum IgA, IgG, and IgM levels were not affected by multiple stimulation with LPS. This may be due to the strong initial humoral immune response of the organism, the rapid action of serum IgG and IgM on the antigen, the increase in protein catabolism, and the inability of immunoglobulin synthesis to satisfy the needs of the stress state of the organism in a short period. Until 12 h, serum IgM returned to normal levels, but serum IgG levels remained deficient. In this study, all chickens fed diets supplemented with yeast had lower serum IgA levels and higher lysozyme levels at 12 h of the first injection compared with those fed diets with antibiotic. The effects of yeast and antibiotics were similar.

Initially, LPS stimulation induces the release of cytokines in vivo. In addition, LPS stimulation is involved in the synthesis of acute-phase proteins and the regulation of the immune system. Changes in cytokines affect not only signaling and the increase of specific cell populations, but also the metabolism and redistribution of nutrients in the body (Klasing, 2007). Due to the high dose of LPS (1 mg/kg), serum cytokines were altered at 3 and 12 h after the initial immunization, and the results were similar to those of Williams et al. (2009). In this study, serum cytokine levels were dynamically monitored after two LPS injections. It was found that anti-inflammatory and pro-inflammatory factors showed corresponding changes, suggesting that the organism has a feedback regulatory role in maintaining the dynamic balance of inflammatory response. At 3 h after the first injection, 0.5% yeast reduced serum TGF-β levels, but had no effect on IL-4 and IL-10 levels, indicating that yeast can prevent excessive inflammatory response of the organism and avoid immune imbalance.

There was an interaction effect between LPS stimulation and diets on IL-1β transcript levels in the liver at 12 h after repeated LPS injections. Compared with saline-injected chickens, LPS stimulation significantly reduced the transcript levels of IL-1β, IL-2, IL-4, and TNF-α in the liver at 3 and 12 h as well as IFN-γ at 3 h after repeated injections, and significantly reduced the transcript levels of IL-1β, TNF-α, and IFN-γ in the spleen at 3 and 12 h as well as IL-6, and IL-10 at 3 h after repeated injections. At the same time, the results showed that the changes in the expression of inflammatory factors in the liver and spleen were consistent with the changes in the expression of inflammatory cytokines in the serum. In LPS-injected flocks, there were no differences in serum immunoglobulin and lysozyme levels when fed diets supplemented with 0.05 or 0.5% yeast compared with those fed antibiotic diets.

 5. Conclusions

The injection of LPS significantly increases the inflammatory response in broiler chickens, while the addition of 0.05 or 0.5% yeast to broiler diets can effectively alleviate this inflammatory response, which has a good prospect of application as an alternative to antibiotics.

 Acknowledgments

Authors acknowledge the National Natural Science Foundation of China (31671010).

 References Al-Ogaili, A. S.; Hameed, S. S. and Noori, N. 2022. LPS-induced NLRP3 gene expression in chicken. Open Veterinary Journal 12:197-203. https://doi.org/10.5455/OVJ.2022.v12.i2.7 Al-Ogaili A. S. Hameed S. S. Noori N. 2022 LPS-induced NLRP3 gene expression in chicken Open Veterinary Journal 12 197 203 https://doi.org/10.5455/OVJ.2022.v12.i2.7 Bai, S. P.; Wu, A. M.; Ding, X. M.; Lei, Y.; Bai, J.; Zhang, K. Y. and Chio, J. S. 2013. Effects of probiotic-supplemented diets on growth performance and intestinal immune characteristics of broiler chickens. Poultry Science 92:663-670. https://doi.org/10.3382/ps.2012-02813 Bai S. P. Wu A. M. Ding X. M. Lei Y. Bai J. Zhang K. Y. Chio J. S. 2013 Effects of probiotic-supplemented diets on growth performance and intestinal immune characteristics of broiler chickens Poultry Science 92 663 670 https://doi.org/10.3382/ps.2012-02813 Cai, G.; Mao, N.; Gu, P.; Zhu, T.; He, J.; Peng, S.; Yang, Y.; Liu, Z; Hu, Y. and Wang, D. 2022. Effects of Alhagi honey polysaccharides as feed supplement on intestine function and microbiome, immune function, and growth performance in chicken. International Journal of Molecular Sciences 23:14332. https://doi.org/10.3390/ijms232214332 Cai G. Mao N. Gu P. Zhu T. He J. Peng S. Yang Y. Liu Z Hu Y. Wang D. 2022 Effects of Alhagi honey polysaccharides as feed supplement on intestine function and microbiome, immune function, and growth performance in chicken International Journal of Molecular Sciences 23 14332 https://doi.org/10.3390/ijms232214332 Cray, C.; Zaias, J. and Altman, N. H. 2009. Acute phase response in animals: A review. Comparative Medicine 59:517-526. Cray C. Zaias J. Altman N. H. 2009 Acute phase response in animals: A review Comparative Medicine 59 517 526 Drazan, K. E.; Wu, L.; Bullington, D. and Shaked, A. 1996. Viral IL-10 gene therapy inhibits TNF-a and IL-1ß, not IL-6, in the newborn endotoxemic mouse. Journal of Pediatric Surgery 31:411-414. https://doi.org/10.1016/S0022-3468 (96)90749-6 Drazan K. E. Wu L. Bullington D. Shaked A. 1996 Viral IL-10 gene therapy inhibits TNF-a and IL-1ß, not IL-6, in the newborn endotoxemic mouse Journal of Pediatric Surgery 31 411 414 https://doi.org/10.1016/S0022-3468 (96)90749-6 Feng, Y.; Yang, X. J.; Wang, Y. B.; Li, W. L.; Liu, Y.; Yin, R. Q. and Yao, J. H. 2012. Effects of immune stress on performance parameters, intestinal enzyme activity and mRNA expression of intestinal transporters in broiler chickens. Asian-Australasian Journal of Animal Sciences 25:701-707. Feng Y. Yang X. J. Wang Y. B. Li W. L. Liu Y. Yin R. Q. Yao J. H. 2012 Effects of immune stress on performance parameters, intestinal enzyme activity and mRNA expression of intestinal transporters in broiler chickens Asian-Australasian Journal of Animal Sciences 25 701 707 Han, J.; Bian, L. Q.; Liu, X. J.; Zhang, F.; Zhang, Y. R. and Yu, N. 2014. Effects of Acanthopanax senticosus polysaccharide supplementation on growth performance, immunity, blood parameters and expression of pro-inflammatory cytokines genes in challenged weaned piglets. Asian-Australasian Journal of Animal Sciences 27:1035-1043. Han J. Bian L. Q. Liu X. J. Zhang F. Zhang Y. R. Yu N. 2014 Effects of Acanthopanax senticosus polysaccharide supplementation on growth performance, immunity, blood parameters and expression of pro-inflammatory cytokines genes in challenged weaned piglets Asian-Australasian Journal of Animal Sciences 27 1035 1043 Klasing, K. C. 2007. Nutrition and the immune system. British Poultry Science 48:525-537. https://doi.org/10.1080/00071660701671336 Klasing K. C. 2007 Nutrition and the immune system British Poultry Science 48 525 537 https://doi.org/10.1080/00071660701671336 Kompiang, I. P. 2002. Effect of yeast: Saccharomyces cerevisiae and marine yeast as probiotic supplement on performance of poultry. Jurnal Ilmu Ternak dan Veteriner 7:18-21. Kompiang I. P. 2002 Effect of yeast: Saccharomyces cerevisiae and marine yeast as probiotic supplement on performance of poultry Jurnal Ilmu Ternak dan Veteriner 7 18 21 Li, K.; Zhang, P.; Shi, B.; Su, J.; Yue, Y.; Tong, M. and Yan, S. 2017. Dietary Artemisia ordosica extract alleviating immune stress in broilers exposed to lipopolysaccharide. Italian Journal of Animal Science 16:301-307. https://doi.org/10.1080/1828051X.2016.1274242 Li K. Zhang P. Shi B. Su J. Yue Y. Tong M. Yan S. 2017 Dietary Artemisia ordosica extract alleviating immune stress in broilers exposed to lipopolysaccharide Italian Journal of Animal Science 16 301 307 https://doi.org/10.1080/1828051X.2016.1274242 Li, R.; Song, Z.; Zhao, J.; Huo, D.; Fan, Z.; Hou, D. X. and He, X. 2018. Dietary L-theanine alleviated lipopolysaccharide-induced immunological stress in yellow-feathered broilers. Animal Nutrition 4:265-272. https://doi.org/10.1016/j.aninu.2018.05.002 Li R. Song Z. Zhao J. Huo D. Fan Z. Hou D. X. He X. 2018 Dietary L-theanine alleviated lipopolysaccharide-induced immunological stress in yellow-feathered broilers Animal Nutrition 4 265 272 https://doi.org/10.1016/j.aninu.2018.05.002 Li, Y.; Zhang, H.; Tu, F.; Cao, J.; Hou, X.; Chen, Y. and Yan, J. 2022. Effects of resveratrol and its derivative pterostilbene on hepatic injury and immunological stress of weaned piglets challenged with lipopolysaccharide. Journal of Animal Science 100:skac339. https://doi.org/10.1093/jas/skac339 Li Y. Zhang H. Tu F. Cao J. Hou X. Chen Y. Yan J. 2022 Effects of resveratrol and its derivative pterostilbene on hepatic injury and immunological stress of weaned piglets challenged with lipopolysaccharide Journal of Animal Science 100 skac339 https://doi.org/10.1093/jas/skac339 Liu, L.; Qin, D.; Wang, X.; Feng, Y.; Yang, X. and Yao, J. 2015. Effect of immune stress on growth performance and energy metabolism in broiler chickens. Food and Agricultural Immunology 26:194-203. https://doi.org/10.1080/09540105.2014.882884 Liu L. Qin D. Wang X. Feng Y. Yang X. Yao J. 2015 Effect of immune stress on growth performance and energy metabolism in broiler chickens Food and Agricultural Immunology 26 194 203 https://doi.org/10.1080/09540105.2014.882884 Liu, J.; Wang, Z.; Li, C.; Chen, Z.; Zheng, A.; Chang, W.; Liu, G. and Cai, H. 2023a. Effects of selenium dietary yeast on growth performance, slaughter performance, antioxidant capacity, and selenium deposition in broiler chickens. Animals 13:3830. https://doi.org/10.3390/ani13243830 Liu J. Wang Z. Li C. Chen Z. Zheng A. Chang W. Liu G. Cai H. 2023a Effects of selenium dietary yeast on growth performance, slaughter performance, antioxidant capacity, and selenium deposition in broiler chickens Animals 13 3830 https://doi.org/10.3390/ani13243830 Liu, K.; Zhen, W.; Bai, D.; Tan, H.; He, X.; Li, Y.; Liu, Y.; Zhang, Y.; Ito, K.; Zhang, B. and Ma, Y. 2023b. Lipopolysaccharide-induced immune stress negatively regulates broiler chicken growth via the COX-2-PGE 2-EP4 signaling pathway. Frontiers in Immunology 14:1193798. https://doi.org/10.3389/fimmu.2023.1193798 Liu K. Zhen W. Bai D. Tan H. He X. Li Y. Liu Y. Zhang Y. Ito K. Zhang B. Ma Y. 2023b Lipopolysaccharide-induced immune stress negatively regulates broiler chicken growth via the COX-2-PGE 2-EP4 signaling pathway Frontiers in Immunology 14 1193798 https://doi.org/10.3389/fimmu.2023.1193798 Livak, K. J. and Schmittgen, T. D. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2 -??C T method. Methods 25:402-408. https://doi.org/10.1006/meth.2001.1262 Livak K. J. Schmittgen T. D. 2001 Analysis of relative gene expression data using real-time quantitative PCR and the 2 -??C T method Methods 25 402 408 https://doi.org/10.1006/meth.2001.1262 Matur, E.; Ergul, E.; Akyazi, I.; Eraslan, E. and Cirakli, Z. T. 2010. The effects of Saccharomyces cerevisiae extract on the weight of some organs, liver, and pancreatic digestive enzyme activity in breeder hens fed diets contaminated with aflatoxins. Poultry Science 89:2213-2220. https://doi.org/10.3382/ps.2010-00821 Matur E. Ergul E. Akyazi I. Eraslan E. Cirakli Z. T. 2010 The effects of Saccharomyces cerevisiae extract on the weight of some organs, liver, and pancreatic digestive enzyme activity in breeder hens fed diets contaminated with aflatoxins Poultry Science 89 2213 2220 https://doi.org/10.3382/ps.2010-00821 Munyaka, P. M.; Tactacan, G.; Jing, M.; Karmin, O.; House, J. D.; Paul, M. S.; Sharif, S. and Rodriguez-Lecompte, J. C. 2013. Response of older laying hens to an Escherichia coli lipopolysaccharide challenge when fed diets with or without supplemental folic acid. Poultry Science 92:105-113. https://doi.org/10.3382/ps.2012-02579 Munyaka P. M. Tactacan G. Jing M. Karmin O. House J. D. Paul M. S. Sharif S. Rodriguez-Lecompte J. C. 2013 Response of older laying hens to an Escherichia coli lipopolysaccharide challenge when fed diets with or without supplemental folic acid Poultry Science 92 105 113 https://doi.org/10.3382/ps.2012-02579 NRC - National Research Council. 1994. Nutrient requirements of poultry. 9th rev. ed. The National Academies Press, Washington, DC. https://doi.org/10.17226/2114 NRC - National Research Council 1994 Nutrient requirements of poultry 9th rev The National Academies Press Washington, DC https://doi.org/10.17226/2114 Pozo, A. L.; Godfrey, E. M. and Bowles, K. M. 2009. Splenomegaly: Investigation, diagnosis and management. Blood Reviews 23:105-111. https://doi.org/10.1016/j.blre.2008.10.001 Pozo A. L. Godfrey E. M. Bowles K. M. 2009 Splenomegaly: Investigation, diagnosis and management Blood Reviews 23 105 111 https://doi.org/10.1016/j.blre.2008.10.001 Shen, Y. B.; Piao, X. S.; Kim, S. W.; Wang, L. and Liu, P. 2010. The effects of berberine on the magnitude of the acute inflammatory response induced by Escherichia coli lipopolysaccharide in broiler chickens. Poultry Science 89:13-19. https://doi.org/10.3382/ps.2009-00243 Shen Y. B. Piao X. S. Kim S. W. Wang L. Liu P. 2010 The effects of berberine on the magnitude of the acute inflammatory response induced by Escherichia coli lipopolysaccharide in broiler chickens Poultry Science 89 13 19 https://doi.org/10.3382/ps.2009-00243 Takahashi, K.; Mashiko, T. and Akiba, Y. 2000. Effect of dietary concentration of xylitol on growth in male broiler chicks during immunological stress. Poultry Science 79:743-747. https://doi.org/10.1093/ps/79.5.743 Takahashi K. Mashiko T. Akiba Y. 2000 Effect of dietary concentration of xylitol on growth in male broiler chicks during immunological stress Poultry Science 79 743 747 https://doi.org/10.1093/ps/79.5.743 Trckova, M.; Faldyna, M.; Alexa, P.; Sramkova Zajacova, Z.; Gopfert, E.; Kumprechtova, D.; Auclair, E. and D'Inca, R. 2014. The effects of live yeast Saccharomyces cerevisiae on postweaning diarrhea, immune response, and growth performance in weaned piglets. Journal of Animal Science 92:767-774. https://doi.org/10.2527/jas.2013-6793 Trckova M. Faldyna M. Alexa P. Sramkova Zajacova Z. Gopfert E. Kumprechtova D. Auclair E. D'Inca R. 2014 The effects of live yeast Saccharomyces cerevisiae on postweaning diarrhea, immune response, and growth performance in weaned piglets Journal of Animal Science 92 767 774 https://doi.org/10.2527/jas.2013-6793 Trevisi, P.; Colombo, M.; Priori, D.; Fontanesi, L.; Galimberti, G.; Calò, G.; Motta, V.; Latorre, R.; Fanelli, F.; Mezzullo, M.; Pagotto, U.; Gherpelli, Y.; D'Inca, R. and Bosi, P. 2015. Comparison of three patterns of feed supplementation with live Saccharomyces cerevisiae yeast on postweaning diarrhea, health status, and blood metabolic profile of susceptible weaning pigs orally challenged with Escherichia coli F4ac. Journal of Animal Science 93:2225-2233. https://doi.org/10.2527/jas.2014-8539 Trevisi P. Colombo M. Priori D. Fontanesi L. Galimberti G. Calò G. Motta V. Latorre R. Fanelli F. Mezzullo M. Pagotto U. Gherpelli Y. D'Inca R. Bosi P. 2015 Comparison of three patterns of feed supplementation with live Saccharomyces cerevisiae yeast on postweaning diarrhea, health status, and blood metabolic profile of susceptible weaning pigs orally challenged with Escherichia coli F4ac Journal of Animal Science 93 2225 2233 https://doi.org/10.2527/jas.2014-8539 Virden, W. S.; Lilburn, M. S.; Thaxton, J. P.; Corzo, A.; Hoehler, D. and Kidd, M. T. 2007. The effect of corticosterone-induced stress on amino acid digestibility in ross broilers. Poultry Science 86:338-342. https://doi.org/10.1093/ps/86.2.338 Virden W. S. Lilburn M. S. Thaxton J. P. Corzo A. Hoehler D. Kidd M. T. 2007 The effect of corticosterone-induced stress on amino acid digestibility in ross broilers Poultry Science 86 338 342 https://doi.org/10.1093/ps/86.2.338 Waititu, S. M.; Yin, F.; Patterson, R.; Rodriguez-Lecompte, J. C. and Nyachoti, C. M. 2016. Short-term effect of supplemental yeast extract without or with feed enzymes on growth performance, immune status and gut structure of weaned pigs challenged with Escherichia coli lipopolysaccharide. Journal of Animal Science and Biotechnology 7:64. https://doi.org/10.1186/s40104-016-0125-5 Waititu S. M. Yin F. Patterson R. Rodriguez-Lecompte J. C. Nyachoti C. M. 2016 Short-term effect of supplemental yeast extract without or with feed enzymes on growth performance, immune status and gut structure of weaned pigs challenged with Escherichia coli lipopolysaccharide Journal of Animal Science and Biotechnology 7 64 https://doi.org/10.1186/s40104-016-0125-5 Wang, K.; Chen, G.; Cao, G.; Xu, Y.; Wang, Y. and Yang, C. 2019. Effects of Clostridium butyricum and Enterococcus faecalis on growth performance, intestinal structure, and inflammation in lipopolysaccharide-challenged weaned piglets. Journal of Animal Science 97:4140-4151. https://doi.org/10.1093/jas/skz235 Wang K. Chen G. Cao G. Xu Y. Wang Y. Yang C. 2019 Effects of Clostridium butyricum and Enterococcus faecalis on growth performance, intestinal structure, and inflammation in lipopolysaccharide-challenged weaned piglets Journal of Animal Science 97 4140 4151 https://doi.org/10.1093/jas/skz235 Williams, P. N.; Collier, C. T.; Carroll, J. A.; Welsh Jr., T. H. and Laurenz, J. C. 2009. Temporal pattern and effect of sex on lipopolysaccharide-induced stress hormone and cytokine response in pigs. Domestic Animal Endocrinology 37:139-147. https://doi.org/10.1016/j.domaniend.2009.04.004 Williams P. N. Collier C. T. Carroll J. A. Welsh T. H. Jr. Laurenz J. C. 2009 Temporal pattern and effect of sex on lipopolysaccharide-induced stress hormone and cytokine response in pigs Domestic Animal Endocrinology 37 139 147 https://doi.org/10.1016/j.domaniend.2009.04.004 Wright, K. J.; Balaji, R.; Hill, C. M.; Dritz, S. S.; Knoppel, E. L. and Minton, J. E. 2000. Integrated adrenal, somatotropic, and immune responses of growing pigs to treatment with lipopolysaccharide. Journal of Animal Science 78:1892-1899. https://doi.org/10.2527/2000.7871892x Wright K. J. Balaji R. Hill C. M. Dritz S. S. Knoppel E. L. Minton J. E. 2000 Integrated adrenal, somatotropic, and immune responses of growing pigs to treatment with lipopolysaccharide Journal of Animal Science 78 1892 1899 https://doi.org/10.2527/2000.7871892x Yang, X. J.; Li, W. L.; Feng, Y. and Yao, J. H. 2011. Effects of immune stress on growth performance, immunity, and cecal microflora in chickens. Poultry Science 90:2740-2746. https://doi.org/10.3382/ps.2011-01591 Yang X. J. Li W. L. Feng Y. Yao J. H. 2011 Effects of immune stress on growth performance, immunity, and cecal microflora in chickens Poultry Science 90 2740 2746 https://doi.org/10.3382/ps.2011-01591 Yu, G. M.; Isobe, N. and Maeda, T. 2017. Protective effect of melatonin on LPS-stimulated granulosa cells in Japanese quail. Journal of Poultry Science 54:319-325. https://doi.org/10.2141/jpsa.0170048 Yu G. M. Isobe N. Maeda T. 2017 Protective effect of melatonin on LPS-stimulated granulosa cells in Japanese quail Journal of Poultry Science 54 319 325 https://doi.org/10.2141/jpsa.0170048