rbz Revista Brasileira de Zootecnia R. Bras. Zootec. 1516-3598 1806-9290 Sociedade Brasileira de Zootecnia 00502 10.37496/rbz5320220122 Breeding and genetics Genetic polymorphisms in SIRT5 gene and their association with carcass traits in Congjiang Xiang pigs 0000-0002-5970-4614 Zhang Xiong Conceptualization 1 0000-0002-8884-3277 Wang Jing Formal analysis 1 0000-0002-1042-1138 Zhao Chunping Writing – original draft 1 0000-0002-7281-0219 Zhang Jing Funding acquisition 1 * Institute of Animal Husbandry and Veterinary Science Guizhou Academy of Agricultural Sciences Guiyang China Institute of Animal Husbandry and Veterinary Science, Guizhou Academy of Agricultural Sciences, Guiyang, China. Corresponding author: gzsxms_zj@163.com

Editors:

Luiz Fernando Brito

Carina Visser

Conflict of Interest

The authors declare no conflict of interest.

 08 05 2024 2024 53 e20220122 10 10 2022 28 01 2024 This is an Open Access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. ABSTRACT

This study was conducted to investigate the polymorphism of the silence information regulator 5 (SIRT5) gene in 103 Congjiang Xiang pigs from Southwest China. We searched for SNP (single nucleotide polymorphism) loci of SIRT5 gene through sequence alignment and PCR. We obtained nine SNP loci: g.14135 A>C (intron 6), g.14247 C>A (intron 6), g.14305 C>T (exon 7), g.14335 C>T (exon 7), g.16603 T>C (intron 7), g.16613 T>C (intron 7), g.16800 G>A (intron 7), g.16812 C>G (intron 7), and g.16916 A>G (exon 8). Further analysis of SNP genotypes associated with the carcass traits of skin thickness, backfat thickness, and eye muscle area was carried out in pigs. We found that the genotypes g.14305 C>T (CC) and g.16812 C>G (CG) had certain advantages for improving the carcass traits of Congjiang Xiang pigs. The haplotype combination of the SIRT5 gene that improved skin thickness was H2H3:CCGGCTCA. These results may provide empirical support for molecular-based breeding of carcass traits in Congjiang Xiang pigs.

 carcass traits Congjiang Xiang pig SIRT5 SNP Science and Technology Program of Guizhou Province (QKHZC[2020]1Y031 1. Introduction

The Congjiang Xiang pig, as a national Grade II protected livestock breed, is a valuable miniature pig breed primarily farmed in Guizhou Province, China. The breed is famous for its small size, early sexual maturity, adaptability to coarse feed, superior meat quality, low level of genetic diversity, and high level of homozygosity (Ran et al., 2016). Previous studies identified APOC3, APOA5, FUT1, PHKG1, and PRKAG3 as candidate genes for pork quality traits and flavor fatty acid composition and content (Jiang et al., 2005; Ryan et al., 2012; Hui et al., 2013; Zappaterra et al., 2019). In addition, SIRT5 (silence information regulator 5), a member of the Sirtuin family, is involved in the metabolic processes of desuccinylation, demalonylation, and deglutarylation (Simó-Mirabet et al., 2018). It has been demonstrated that SIRT5 regulates the balance of fatty acid oxidation in mice (Rardin et al., 2013). The browning of subcutaneous white fat in SIRT5 knockout mice was impaired, indicating that SIRT5 is also a key factor in the differentiation of brown fat (Shuai et al., 2019). In livestock, SIRT5 has been demonstrated to regulate fat deposition in a Chinese indigenous cattle breed (Deng, 2014). However, little is known about SIRT5 polymorphism in pigs.

In recent years, studies with Congjiang Xiang pigs have focused on the processes of their testis development, fertility, and germplasm resources (Tang et al., 2018; Meng et al., 2020; Gong et al., 2021). Carcass traits have always been an economic concern in pig breeding. The Congjiang Xiang pig is an economically important species in China, and thus it is worthwhile to improve its carcass traits.

In this study, we identified polymorphism of SIRT5 and examined its relationship with carcass traits. Therefore, this study aimed to provide a foundation for applying the SIRT5 gene in the breeding of Congjiang Xiang pigs.

 2. Material and Methods

The study was carried out in Guiyang, Guizhou, China (26°63'65" N latitude, 106°75'75" E longitude, and elevation of 1125 m). Research on animals was approved by the institutional committee on animal use (case number: EAE-GZU-2021-T113). The experimental animals were maintained and processed in accordance with institutional guidelines for the care and use of animals.

2.1. Experimental animals and sample collection

One hundred and three blood samples were collected from healthy eight-month-old male Congjiang Xiang pigs, and the carcass traits of these pigs were measured. All pigs were obtained from a commercial farm in Southwest China (Guizhou Province).

 2.2. Carcass trait measurement

The skin thickness (from the 6th to the 7th ribs of the right half of the carcass of each pig), backfat thickness (the average thickness of the thickest part of the shoulder, the joint of the thoracolumbar vertebrae, and the joint of the lumbar-sacral vertebrae on the right side of each pig), and eye muscle area (the area of a transverse section of the longissimus dorsi muscle at the last rib on the left side of the carcass) were measured using calipers (HOLEX, Germany) after slaughter.

 2.3. Acquisition of DNA

Genomic DNA was extracted from each pig blood sample using an Ezup Column Genomic DNA Extraction Kit (Blood) (Sangon, China) and stored at –20 °C.

 2.4. Primer design and synthesis

The porcine SIRT5 gene complete sequence (accession no.: NC_010449.5) was obtained from GenBank (https://www.ncbi.nlm.nih.gov/). Primers were designed using Primer Premier 5.0 (Singh et al., 1998) and synthesized by Sangon Co., Ltd., China. Table 1 lists the primer sequences and product lengths.

Information of primers
Primer name Primer sequence Tm (℃) Production length (bp)
SIRT5-1 F: CTAGGAGCGCCTGAGAACAC 60 436
R: CAGAGTGGCTTTCTCCAAGG
       
SIRT5-2 F: GAGGTGCGTGGCGAGGTTT 59 472
R: ATCCAGCGTTGCCGTGAGC
       
SIRT5-3 F: GATTTTCCAGGGTCCCTCAT 58 505
R: CACTCCAGGATCGTGTTAAGC
       
SIRT5-4 F: AGTCCCTGGTCGCGTAGTAA 58 522
R: TCCTGTGGTTTGCACTGAAC
       
SIRT5-5 F: CTCTGGAGGGAGAACCACTG 58 636
R: CCTGTCACCCCAGGCTAATA
       
SIRT5-6 F: GGCACCTAAAAGCAGGACAA 58 560
R: AGGGGAAAGGCTTTGAGAAG
       
SIRT5-7 F: GCACAACCAGAATGTGAACG 57 554
R: CGTTTGCTTCCATCAGAACA
       
SIRT5-8 F: ATCATCTGTGTGGTGCCTGA 60 656
R: ACACCTTTACTCCCCCTGCT

2.5. Sequencing of the <italic>SIRT5</italic> gene

The SIRT5 gene was characterized from 103 blood samples using the polymerase chain reaction (PCR), which was performed in a 20-μL reaction mixture containing 10 μL of 2 × Taq PCR Master Mix (CW Biotech, China), 1 μL of primers (10 μmol/L), 1 μL of complementary DNA (cDNA), and 7 μL of double distilled water (ddH2O). The reaction was pre-denatured for 2 min at 94 °C, followed by 35 cycles of denaturation for 30 s at 94 °C, annealing for 10 s at 60 °C, and extension for 30 s at 72 °C followed by a final extension for 30 s at 72 °C.

After electrophoresis, the rubber plate was removed, and the gel was placed in an irradiation instrument to observe the target bands. The optimal products were sent to Sangon Co., Ltd. (Shanghai, China), for sequencing, sequence alignment, single nucleotide polymorphism (SNP) analysis, and genotype determination.

 2.6. Statistical analysis

The genotype frequency, allele frequency, polymorphism information content (PIC), effective number of alleles (Ne), heterozygosity (He), and homozygosity (Ho) were calculated. The statistical analysis of the associations between the carcass traits and the SNP of the SIRT5 gene was performed using SPSS Statistics 18. Duncan’s method was used for multiple comparisons. A P-value < 0.05 was considered significant. Values are reported as the mean ± standard deviation (SD). Haplotype analysis was performed using SHEsis software (http://analysis.bio-x.cn/myAnalysis.php). The equation for the animal model used was as follows:

Y i j = μ + h i + e i j

in which Yij is the trait being measured, μ is the population mean, hi is the effect of genotype or combined haplotype, and eij is the random error term.

 3. Results 3.1. SNP locus mapping

We compared the results of SIRT5 gene with its gene sequences. DNAMAN software was used for the comparison process. In the comparative analysis, nine SNP were mined, and SNP were present in all of the exonic regions and several of the intronic regions of the SIRT5 gene in the Congjiang Xiang pig sequences.

Referring to the complete sequence of the porcine SIRT5 gene (taking the first transcription start site +1), the nine SNP (Figure 1) were named g.14135 A>C (intron 6), g.14247 C>A (intron 6), g.14305 C>T (exon 7), g.14335 C>T (exon 7), g.16603 T>C (intron 7), g.16613 T>C (intron 7), g.16800 G>A (intron 7), g.16812 C>G (intron 7), and g.16916 A>G (exon 8).

Sequencing map of <italic>SIRT5</italic> gene SNP in Congjiang Xiang pigs.

3.2. Genetic diversity analysis

The Ne values of g.16603 T>C, g.16613 T>C, and g.16916 A>G loci were close to 2, indicating that the alleles of these three variants were evenly distributed in Congjiang Xiang pigs. The Ne and He values of the g.14135 A>C, g.14247 C>A, g.14305 C>T, and g.16800 G>A loci were low, indicating relatively low genetic variability and insufficient diversity excavation of species resources. The PIC values of these four loci were low polymorphic (PIC < 0.25), indicating that the genetic marker loci provided little genetic information (Table 2).

Genetic indices of <italic>SIRT5</italic> gene SNP site from Congjiang Xiang pigs
Site Genotype Genotype frequency Allele Allele frequency Ne Ho He PIC
  AA 0.8852 A 0.9426        
g.14135 A>C AC 0.1148     1.1213 0.8918 0.1082 0.1023
  CC 0 C 0.0574        
                 
  AA 0 A 0.0574        
g.14247 C>A AC 0.1148     1.1213 0.8918 0.1082 0.1023
  CC 0.8852 C 0.9426        
                 
  CC 0.9344 C 0.9672        
g.14305 C>T CT 0.0656     1.0677 0.9366 0.0634 0.0614
  TT 0 T 0.0328        
                 
  CC 0.4918 C 0.7131        
g.14335 C>T CT 0.4426     1.6925 0.5908 0.4092 0.3255
  TT 0.0656 T 0.2869        
                 
  CC 0.2917 C 0.5625        
g.16603 T>C CT 0.5417     1.9692 0.5078 0.4922 0.3711
  TT 0.1667 T 0.4375        
                 
  CC 0.2917 C 0.5625        
g.16613 T>C CT 0.5417     1.9692 0.5078 0.4922 0.3711
  TT 0.1667 T 0.4375        
                 
  AA 0 A 0.0833        
g.16800 G>A AG 0.1667     1.1803 0.8472 0.1528 0.1411
  GG 0.8333 G 0.9167        
                 
  CC 0.4792 C 0.6667        
g.16812 C>G CG 0.3750     1.8000 0.5556 0.4444 0.3457
  GG 0.1458 G 0.3333        
                 
  AA 0.1667 A 0.4167        
g.16916 A>G AG 0.5000     1.9459 0.5139 0.4861 0.3680
  GG 0.3333 G 0.5833        

SNP - single nucleotide polymorphism; Ne - effective number of alleles; Ho - homozygosity; He - heterozygosity; PIC - polymorphism information content.

 3.3. Correlations between <italic>SIRT5</italic> gene variation and traits

The correlations between SIRT5 variation and traits in the Congjiang Xiang pigs were measured (Table 3). The skin thickness of individuals with the g.14305 C>T locus CC type was higher than that of individuals with the TT genotype by 14.04% (P<0.05). The skin thickness and eye muscle area of individuals with the g.16812 C>G locus CG type were greater than those of individuals with the GG type by 28.12 and 17.99%, respectively (P<0.05), but the difference in the level of individuals with the CC type was not significant (P>0.05).

Correlations between <italic>SIRT5</italic> variation loci and traits in the Congjiang Xiang pig
Site Genotype Skin thickness (mm) Backfat thickness (mm) Eye muscle area (cm2)
  AA 3.89±0.83 21.55±5.86 16.96±3.31
g.14135 A>C        
  AC 4.42±1.06 23.88±4.50 17.19±2.91
         
  AC 4.42±1.06 23.88±4.50 17.19±2.91
g.14247 C>A        
  CC 3.89±0.83 21.55±5.86 16.96±3.31
         
  CC 3.98±0.88a 22.00±5.81 17.08±3.36
g.14305 C>T        
  CT 3.49±0.12b 18.64±3.09 15.73±1.07
         
  CC 3.96±0.79 22.07±6.57 16.28±2.81
g.14335 C>T CT 3.99±0.95 21.88±4.80 17.56±3.59
  TT 3.73±1.08 19.82±6.45 18.57±3.38
         
  CC 3.69±0.94 21.68±5.74 16.99±3.51
g.16603 T>C CT 3.86±0.74 21.99±5.25 16.87±2.86
  TT 3.99±0.90 24.18±7.51 16.48±3.59
         
  CC 3.69±0.94 21.68±5.74 16.99±3.51
g.16613 T>C CT 3.86±0.74 21.99±5.25 16.87±2.86
  TT 3.99±0.90 24.18±7.51 16.48±3.59
         
  AG 3.89±0.67 21.83±6.43 16.99±2.41
g.16800 G>A        
  GG 3.83±0.84 22.37±5.67 16.81±3.26
         
  CC 3.81±0.91ab 22.54±6.02 17.00±3.33ab
g.16812 C>G CG 4.10±0.68a 22.53±5.86 17.44±2.89a
  GG 3.20±0.44b 20.53±4.70 14.78±2.38b
         
  AA 3.99±0.90 24.18±7.51 16.48±3.59
g.16916 A>G AG 3.87±0.76 22.06±5.43 16.60±3.13
  GG 3.71±0.90 21.15±5.85 17.49±3.64

a-b - Means in the same single nucleotide polymorphism site within a column with different letters differ by P<0.05.

 3.4. Haplotype combination analysis of different SNP loci

There were five haplotypes of four SNP loci (g.14335 C>T, g.16613 T>C, g.16812 C>G, and g.16916 A>G) in 43 Congjiang Xiang pigs, named H1:CCCG, H2:CCGG, H3:CTCA, H4:TCCG, and H5:TCGG, which were analyzed by the SHEsis software. Among these, H2, H3, and H4 were the main haplotypes, with frequencies of 27.8, 44.2, and 17.3%, respectively, while the H1 haplotype had the lowest frequency of 3.6% (Table 4).

Haplotype construction and frequency of four SNP loci of <italic>SIRT5</italic> gene
Haplotype g.14335 C>T g.16613 T>C g.16812 C>G g.16916 A>G Frequency (%)
H1 C C C G 3.6
H2 C C G G 27.8
H3 C T C A 44.2
H4 T C C G 17.3
H5 T C G G 7.1

SNP - single nucleotide polymorphism.

There were four haplotype combinations in 43 Congjiang Xiang pigs, H2H2:CCGGCCGG, H2H3:CCGGCTCA, H3H3:CTCACTCA, and H3H4:CTCATCCG. We found that skin thickness associated with H2H3 was superior to the H2H2 haplotype combination (Table 5).

Haplotype combination analysis of four SNP loci of the <italic>SIRT5</italic> gene
Haplotype combination Skin thickness (mm) Backfat thickness (mm) Eye muscle area (cm2)
H2H2 3.18±0.49a 19.81±4.87 14.36±2.76
H2H3 4.03±0.55b 20.25±5.13 16.72±1.52
H3H3 3.99±0.90ab 24.18±7.52 16.48±3.59
H3H4 3.62±0.73ab 20.91±5.60 17.77±4.16

SNP - single nucleotide polymorphism.

a-b - Means in the haplotype combination within a column with different letters differ by P<0.05.

4. Discussion

Recent studies have reported that the SIRT5 gene regulates the activity of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) through demethylation and further upregulates glycolytic flux (Nishida et al., 2015). SIRT5 also increases the activity of very long-chain acyl-CoA dehydrogenase (VLCAD) by desuccinylation to promote fatty acid β-oxidation and ketone body production (Zhang et al., 2015). Hong et al. (2020) reported that during the differentiation of preadipocytes, SIRT5 inhibited the expression of key genes that promote lipid formation and differentiation in fatty acid biosynthesis and PPAR pathways. SIRT5 plays an important role in biological processes such as maintaining the balance of lipid metabolism and promoting the mobilization of fatty acid oxidation. However, little is known concerning SNP of the SIRT5 gene in pigs. Our study detected nine SNP loci in the SIRT5 gene. As mentioned above, SIRT5 significantly inhibits the differentiation of bovine preadipocytes and simultaneously inhibits lipid synthesis and lipid deposition in adipocytes (Hong et al., 2020), and thus we speculated that the nine sites identified in this study may have potential roles in production and breeding of Congjiang Xiang pigs. The genetic diversity of these nine loci was quite different in Congjiang Xiang pigs. We used PIC values as indicators to evaluate the degree of genetic variation in the population. The PIC can be used to classify loci as highly polymorphic (PIC > 0.5), medium polymorphic (PIC between 0.25 and 0.5), and low polymorphic (PIC < 0.25). According to the PIC values, g.14135 A>C, g.14247 C>A, g.14305 C>T, and g.16800 G>A loci were low polymorphic in Congjiang Xiang pigs (PIC < 0.25). We speculate that the reasons for these results may be related to the intensity of artificial selection that may have affected allele frequencies and genotype frequencies (Zhang et al., 2023).

In this study, the g.14305 C>T locus genotype was significantly associated with skin thickness, and CC was the dominant genotype. The g.16812 C>G locus genotype was significantly associated with skin thickness and eye muscle area, and CG was the dominant genotype. Although the g.16812 C>G locus is in the intron and cannot be directly involved in protein coding, it has been demonstrated that mutations in the non-coding region affect processes such as mRNA stabilization, localization, and translation (Kosinska-Selbi et al., 2020). Compared with SNP genotyping, haplotype combination analysis can provide a more comprehensive reference as to functional significance, because the various loci in the haplotype combination will affect each other rather than acting as a simple combination of various genotypes (Wang et al., 2011). We combined the haplotypes of the four SNP loci of the SIRT5 gene and analyzed their correlations with carcass traits. The results showed that the dominant haplotype combination for skin thickness of the SIRT5 gene was H2H3:CCGGCTCA.

 5. Conclusions

This study identified nine SNP loci through analysis of SIRT5 gene in Congjiang Xiang pigs. The CC genotype of the g.14305 C>T locus and the CG genotype of the g.16812 C>G locus were the dominant genotypes associated with carcass traits; and H2H3:CCGGCTCA was associated with skin thickness. These dominant genotype and haplotype combinations can be used as a primary reference in the breeding of Congjiang Xiang pigs.

 Acknowledgments

We thank LetPub for its linguistic assistance during the preparation of this manuscript. The authors are grateful to the Science and Technology Program of Guizhou Province (QKHZC[2020]1Y031) for funding and facilitating this study.

 References Deng, G. Q. 2014. SNPs detection of Sirt3 and Sirt5 genes in Qinchuan cattle and their correlation with body size and meat quality traits. Master's thesis. Northwest A&F University, Yangling, China. Deng G. Q. 2014 SNPs detection of Sirt3 and Sirt5 genes in Qinchuan cattle and their correlation with body size and meat quality traits Master's thesis Northwest A&F University Yangling, China Gong, T.; Wang, W.; Xu, H.; Yang, Y.; Chen, X.; Meng, L.; Xu, Y.; Li, Z.; Wan, S. and Mu, Q. 2021. Longitudinal expression of testicular TAS1R3 from prepuberty to sexual maturity in Congjiang Xiang pigs. Animals 11:437. https://doi.org/10.3390/ani11020437 Gong T. Wang W. Xu H. Yang Y. Chen X. Meng L. Xu Y. Li Z. Wan S. Mu Q. 2021 Longitudinal expression of testicular TAS1R3 from prepuberty to sexual maturity in Congjiang Xiang pigs Animals 11 437 https://doi.org/10.3390/ani11020437 Hong, J. Y.; Mei, C. G.; Raza, S. H. A.; Khana, R. W.; Cheng, G. and Zan, L. S. 2020. SIRT5 inhibits bovine preadipocyte differentiation and lipid deposition by activating AMPK and repressing MAPK signal pathways. Genomics 112:1065-1076. https://doi.org/10.1016/j.ygeno.2019.12.004 Hong J. Y. Mei C. G. Raza S. H. A. Khana R. W. Cheng G. Zan L. S. 2020 SIRT5 inhibits bovine preadipocyte differentiation and lipid deposition by activating AMPK and repressing MAPK signal pathways Genomics 112 1065 1076 https://doi.org/10.1016/j.ygeno.2019.12.004 Hui, Y. T.; Yang, Y. Q.; Liu, R. Y.; Zhang, Y. Y.; Xiang, C. J.; Liu, Z. Z.; Ding, Y. H.; Zhang, Y. L. and Wang, B. R. 2013. Significant association of APOA5 and APOC3 gene polymorphisms with meat quality traits in Kele pigs. Genetics and Molecular Research 12:3643-3650. https://doi.org/10.4238/2013.September.13.8 Hui Y. T. Yang Y. Q. Liu R. Y. Zhang Y. Y. Xiang C. J. Liu Z. Z. Ding Y. H. Zhang Y. L. Wang B. R. 2013 Significant association of APOA5 and APOC3 gene polymorphisms with meat quality traits in Kele pigs Genetics and Molecular Research 12 3643 3650 https://doi.org/10.4238/2013.September.13.8 Jiang, X. P.; Liu, Y. G.; Xiong, Y. Z. and Deng, C. Y. 2005. Effects of FUT1 gene on meat quality and carcass traits in swine. Yi Chuan 27:566-570. Jiang X. P. Liu Y. G. Xiong Y. Z. Deng C. Y. 2005 Effects of FUT1 gene on meat quality and carcass traits in swine Yi Chuan 27 566 570 Kosinska-Selbi, B.; Mielczarek, M. and Szyda, J. 2020. Review: Long non-coding RNA in livestock. Animal 14:2003-2013. https://doi.org/10.1017/S1751731120000841 Kosinska-Selbi B. Mielczarek M. Szyda J. 2020 Review: Long non-coding RNA in livestock Animal 14 2003 2013 https://doi.org/10.1017/S1751731120000841 Meng, L. J.; Wang, W. Y.; Xu, Y. J.; Gong, T. and Yang, Y. 2020. Postnatal differentiation and regional histological variations in the ductus epididymidis of the Congjiang Xiang pig. Tissue and Cell 67:101411. https://doi.org/10.1016/j.tice.2020.101411 Meng L. J. Wang W. Y. Xu Y. J. Gong T. Yang Y. 2020 Postnatal differentiation and regional histological variations in the ductus epididymidis of the Congjiang Xiang pig Tissue and Cell 67 101411 https://doi.org/10.1016/j.tice.2020.101411 Nishida, Y.; Rardin, J. M.; Carrico, C.; He, W.; Sahu, A. K.; Gut, P.; Najjar, R.; Fitch, M.; Hellerstein, M.; Gibson, B. W. and Verdin, E. 2015. SIRT5 Regulates both cytosolic and mitochondrial protein malonylation with glycolysis as a major target. Molecular Cell 59:321-332. https://doi.org/10.1016/j.molcel.2015.05.022 Nishida Y. Rardin J. M. Carrico C. He W. Sahu A. K. Gut P. Najjar R. Fitch M. Hellerstein M. Gibson B. W. Verdin E. 2015 SIRT5 Regulates both cytosolic and mitochondrial protein malonylation with glycolysis as a major target Molecular Cell 59 321 332 https://doi.org/10.1016/j.molcel.2015.05.022 Ran, M. L. ; Wang, M. F. ; Yang, A. Q. ; Li, Z. and Chen, B. 2016. The complete mitochondrial genome of Congjiang miniature pig ( Sus scrofa ). Mitochondrial DNA Part A 27:1787-1788. https://doi.org/10.3109/19401736.2014.963813 Ran M. L. Wang M. F. Yang A. Q. Li Z. Chen B. 2016 The complete mitochondrial genome of Congjiang miniature pig ( Sus scrofa ) Mitochondrial DNA Part A 27 1787 1788 https://doi.org/10.3109/19401736.2014.963813 Rardin, M. J.; He, W.; Nishida, Y.; Newman, J. C.; Carrico, C.; Danielson, S. R.; Guo, A.; Gut, P.; Sahu, A. K.; Li, B.; Uppala, R.; Fitch, M.; Riiff, T.; Zhu, L.; Zhou, J.; Mulhern, D.; Stevens, R. D.; Ilkayeva, O. R.; Newgard, C. B.; Jacobson, M. P.; Hellerstein, M.; Goetzman, E. S.; Gibson, B. W. and Verdin, E. 2013. SIRT5 regulates the mitochondrial lysine succinylome and metabolic networks. Cell Metabolism 18:920-933. https://doi.org/10.1016/j.cmet.2013.11.013 Rardin M. J. He W. Nishida Y. Newman J. C. Carrico C. Danielson S. R. Guo A. Gut P. Sahu A. K. Li B. Uppala R. Fitch M. Riiff T. Zhu L. Zhou J. Mulhern D. Stevens R. D. Ilkayeva O. R. Newgard C. B. Jacobson M. P. Hellerstein M. Goetzman E. S. Gibson B. W. Verdin E. 2013 SIRT5 regulates the mitochondrial lysine succinylome and metabolic networks Cell Metabolism 18 920 933 https://doi.org/10.1016/j.cmet.2013.11.013 Ryan, M. T.; Hamill, R. M.; O'Halloran, A. M.; Davey, G. C.; McBryan, J.; Mullen, A. M.; McGee, C.; Gispert, M.; Southwood, O. I. and Sweeney, T. 2012. SNP variation in the promoter of the PRKAG3 gene and association with meat quality traits in pig. BMC Genetics 13:66. https://doi.org/10.1186/1471-2156-13-66 Ryan M. T. Hamill R. M. O'Halloran A. M. Davey G. C. McBryan J. Mullen A. M. McGee C. Gispert M. Southwood O. I. Sweeney T. 2012 SNP variation in the promoter of the PRKAG3 gene and association with meat quality traits in pig BMC Genetics 13 66 https://doi.org/10.1186/1471-2156-13-66 Shuai, L.; Zhang, L. N.; Li, B. H.; Tang, C. L.; Wu, L. Y.; Li, J. and Li, J. Y. 2019. SIRT5 Regulates brown adipocyte differentiation and browning of subcutaneous white adipose tissue. Diabetes 68:1449-1461. https://doi.org/10.2337/db18-1103 Shuai L. Zhang L. N. Li B. H. Tang C. L. Wu L. Y. Li J. Li J. Y. 2019 SIRT5 Regulates brown adipocyte differentiation and browning of subcutaneous white adipose tissue Diabetes 68 1449 1461 https://doi.org/10.2337/db18-1103 Simó-Mirabet, P. ; Perera, E. ; Calduch-Giner, J. A. ; Afonso, J. M. and Pérez-Sánchez, J. 2018. Co-expression analysis of sirtuins and related metabolic biomarkers in juveniles of gilthead sea bream ( Sparus aurata ) with differences in growth performance. Frontiers in Physiology 9:608. https://doi.org/10.3389/fphys.2018.00608 Simó-Mirabet P. Perera E. Calduch-Giner J. A. Afonso J. M. Pérez-Sánchez J. 2018 Co-expression analysis of sirtuins and related metabolic biomarkers in juveniles of gilthead sea bream ( Sparus aurata ) with differences in growth performance Frontiers in Physiology 9 608 https://doi.org/10.3389/fphys.2018.00608 Singh, V. K.; Mangalam, A. K.; Dwivedi, S. and Naik, S. 1998. Primer premier: program for design of degenerate primers from a protein sequence. BioTechniques 24:318-319. https://doi.org/10.2144/98242pf02 Singh V. K. Mangalam A. K. Dwivedi S. Naik S. 1998 Primer premier: program for design of degenerate primers from a protein sequence BioTechniques 24 318 319 https://doi.org/10.2144/98242pf02 Tang, L. T.; Ran, X. Q.; Mao, N.; Zhang, F. P.; Niu, X.; Ruan, Y. Q.; Yi, F. L.; Li, S. and Wang, J. F. 2018. Analysis of alternative splicing events by RNA sequencing in the ovaries of Xiang pig at estrous and diestrous. Theriogenology 119:60-68. https://doi.org/10.1016/j.theriogenology.2018.06.022 Tang L. T. Ran X. Q. Mao N. Zhang F. P. Niu X. Ruan Y. Q. Yi F. L. Li S. Wang J. F. 2018 Analysis of alternative splicing events by RNA sequencing in the ovaries of Xiang pig at estrous and diestrous Theriogenology 119 60 68 https://doi.org/10.1016/j.theriogenology.2018.06.022 Wang, Z. Y.; Wang, G. L.; Huang, J. M.; Li, Q. L.; Wang, C. F. and Zhong, J. F. 2011. Novel SNPs in the ATP1B2 gene and their associations with milk yield, milk composition and heat-resistance traits in Chinese Holstein cows. Molecular Biology Reports 38:1749-1755. https://doi.org/10.1007/s11033-010-0289-6 Wang Z. Y. Wang G. L. Huang J. M. Li Q. L. Wang C. F. Zhong J. F. 2011 Novel SNPs in the ATP1B2 gene and their associations with milk yield, milk composition and heat-resistance traits in Chinese Holstein cows Molecular Biology Reports 38 1749 1755 https://doi.org/10.1007/s11033-010-0289-6 Zappaterra, M.; Sami, D. and Davoli, R. 2019. Association between the splice mutation g.8283C>A of the PHKG1 gene and meat quality traits in Large White pigs. Meat Science 148:38-40. https://doi.org/10.1016/j.meatsci.2018.10.003 Zappaterra M. Sami D. Davoli R. 2019 Association between the splice mutation g.8283C>A of the PHKG1 gene and meat quality traits in Large White pigs Meat Science 148 38 40 https://doi.org/10.1016/j.meatsci.2018.10.003 Zhang, Y. X.; Bharathi, S. S.; Rardin, M. J.; Uppala, R.; Verdin, E.; Gibson, B. W. and Goetzman, E. S. 2015. SIRT3 and SIRT5 regulate the enzyme activity and cardiolipin binding of very long-chain acyl-CoA dehydrogenase. PLoS ONE 10:e0122297. https://doi.org/10.1371/journal.pone.0122297 Zhang Y. X. Bharathi S. S. Rardin M. J. Uppala R. Verdin E. Gibson B. W. Goetzman E. S. 2015 SIRT3 and SIRT5 regulate the enzyme activity and cardiolipin binding of very long-chain acyl-CoA dehydrogenase PLoS ONE 10 e0122297 https://doi.org/10.1371/journal.pone.0122297 Zhang, Y.; Qin, Y. T.; Gu, M.; Xu, Y. A.; Dou, X. T.; Han, D.; Lin, G. Y.; Wang, L. L.; Wang, Z. H.; Wang, J. M.; Sun, Y. G.; Wu, Y. Z.; Chen, R.; Qiao, Y. J.; Zhang, Q.; Li, Q.; Wang, X. W.; Xu, Z. G.; Cong, Y. Y.; Chen, J. and Wang, Z. Y. 2023. Association between the cashmere production performance, milk production performance, and body size traits and polymorphism of COL6A5 and LOC102181374 genes in Liaoning cashmere goats. Animal Biotechnology 34:4415-4429. https://doi.org/10.1080/10495398.2022.2155177 Zhang Y ; Qin, Y 2023 Animal Biotechnology 34 4415 4429 https://doi.org/10.1080/10495398.2022.2155177