<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.1 20151215//EN" "https://jats.nlm.nih.gov/publishing/1.1/JATS-journalpublishing1.dtd">
<article xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:mml="http://www.w3.org/1998/Math/MathML" dtd-version="1.1" specific-use="sps-1.9" article-type="research-article" xml:lang="en">
<front>
		<journal-meta>
			<journal-id journal-id-type="publisher-id">rbz</journal-id>
			<journal-title-group>
				<journal-title>Revista Brasileira de Zootecnia</journal-title>
				<abbrev-journal-title abbrev-type="publisher">R. Bras. Zootec.</abbrev-journal-title>
			</journal-title-group>
			<issn pub-type="ppub">1516-3598</issn>
			<issn pub-type="epub">1806-9290</issn>
			<publisher>
				<publisher-name>Sociedade Brasileira de Zootecnia</publisher-name>
			</publisher>
		</journal-meta>
<article-meta>
<article-id pub-id-type="other">00614</article-id>
<article-id pub-id-type="doi">10.37496/rbz5120220077</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Non-Ruminants</subject></subj-group></article-categories>
<title-group>
<article-title>Capsaicinoids affect intestinal mRNA expression of genes related to oxidative stress in broilers</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<contrib-id contrib-id-type="orcid">0000-0001-9676-3341</contrib-id>
<name><surname>Kreuz</surname><given-names>Bruna Strieder</given-names></name>
<role>Conceptualization</role>
<role>Formal analysis</role>
<role>Investigation</role>
<role>Investigation</role>
<role>Methodology</role>
<role>Writing &#x2013; original draft</role>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib>
<contrib contrib-type="author">
<contrib-id contrib-id-type="orcid">0000-0002-5795-6420</contrib-id>
<name><surname>Duarte</surname><given-names>Marcio de Souza</given-names></name>
<role>Conceptualization</role>
<role>Formal analysis</role>
<role>Supervision</role>
<role>Writing &#x2013; review &#x26; editing</role>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
</contrib>
<contrib contrib-type="author">
<contrib-id contrib-id-type="orcid">0000-0002-2753-2010</contrib-id>
<name><surname>Albino</surname><given-names>Luiz Fernando Teixeira</given-names></name>
<role>Project administration</role>
<role>Supervision</role>
<role>Writing &#x2013; review &#x26; editing</role>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib>
<contrib contrib-type="author">
<contrib-id contrib-id-type="orcid">0000-0002-7695-7760</contrib-id>
<name><surname>Borges</surname><given-names>Samuel Oliveira</given-names></name>
<role>Data curation</role>
<role>Investigation</role>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib>
<contrib contrib-type="author">
<contrib-id contrib-id-type="orcid">0000-0002-7966-6280</contrib-id>
<name><surname>Piazza</surname><given-names>Maria Clara Neres</given-names></name>
<role>Investigation</role>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib>
<contrib contrib-type="author">
<contrib-id contrib-id-type="orcid">0000-0002-1729-8128</contrib-id>
<name><surname>Carvalho</surname><given-names>Marcela Eduarda Silva de</given-names></name>
<role>Investigation</role>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib>
<contrib contrib-type="author">
<contrib-id contrib-id-type="orcid">0000-0002-8894-8511</contrib-id>
<name><surname>Miranda</surname><given-names>Jo&#xE3;o Victor de Souza</given-names></name>
<role>Investigation</role>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib>
<contrib contrib-type="author">
<contrib-id contrib-id-type="orcid">0000-0002-2282-3580</contrib-id>
<name><surname>Calderano</surname><given-names>Arele Arlindo</given-names></name>
<role>Conceptualization</role>
<role>Data curation</role>
<role>Formal analysis</role>
<role>Funding acquisition</role>
<role>Investigation</role>
<role>Methodology</role>
<role>Project administration</role>
<role>Supervision</role>
<role>Validation</role>
<role>Visualization</role>
<role>Writing &#x2013; review &#x26; editing</role>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="aff" rid="aff3"><sup>3</sup></xref><xref ref-type="corresp" rid="c1">*</xref></contrib>
<aff id="aff1">
<label>1</label>
<institution content-type="orgname">Universidade Federal de Vi&#xE7;osa</institution>
<institution content-type="orgdiv1">Departamento de Zootecnia</institution>
<addr-line>
<named-content content-type="city">Vi&#xE7;osa</named-content>
<named-content content-type="state">MG</named-content></addr-line>
<country country="BR">Brasil</country>
<institution content-type="original">Universidade Federal de Vi&#xE7;osa, Departamento de Zootecnia, Vi&#xE7;osa, MG, Brasil.</institution></aff>
<aff id="aff2">
<label>2</label>
<institution content-type="orgname">University of Guelph</institution>
<institution content-type="orgdiv1">Department of Animal Biosciences</institution>
<addr-line>
<named-content content-type="city">Guelph</named-content>
<named-content content-type="state">ON</named-content></addr-line>
<country country="CA">Canada</country>
<institution content-type="original">University of Guelph, Department of Animal Biosciences, Guelph, ON, Canada.</institution></aff>
<aff id="aff3">
<label>3</label>
<institution content-type="orgname">Universidade Federal de Vi&#xE7;osa</institution>
<institution content-type="orgdiv1">Laborat&#xF3;rio Multiusu&#xE1;rio de Biologia Muscular e Nutrigen&#xF4;mica</institution>
<addr-line>
<named-content content-type="city">Vi&#xE7;osa</named-content>
<named-content content-type="state">MG</named-content></addr-line>
<country country="BR">Brasil</country>
<institution content-type="original">Universidade Federal de Vi&#xE7;osa, Laborat&#xF3;rio Multiusu&#xE1;rio de Biologia Muscular e Nutrigen&#xF4;mica, Vi&#xE7;osa, MG, Brasil.</institution></aff>
</contrib-group>
<author-notes>
<corresp id="c1"><label>*</label><bold>Corresponding author:</bold> <email>calderano@ufv.br</email></corresp>
<fn fn-type="conflict">
<p><bold>Conflict of Interest</bold></p>
<p>The authors declare no conflict of interest.</p></fn>
</author-notes>
<pub-date publication-format="electronic" date-type="pub">
<day>21</day>
<month>11</month>
<year>2022</year>
</pub-date>
<pub-date publication-format="electronic" date-type="collection">
<year>2022</year>
</pub-date>
<volume>51</volume>
<elocation-id>e20220077</elocation-id>
<history>
<date date-type="received">
<day>20</day>
<month>05</month>
<year>2022</year></date>
<date date-type="accepted">
<day>26</day>
<month>09</month>
<year>2022</year></date>
</history>
<permissions>
<license license-type="open-access" xlink:href="http://creativecommons.org/licenses/by/4.0/" xml:lang="en">
<license-p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p></license></permissions>
<abstract>
<title>ABSTRACT</title>
<p>This study was conducted to evaluate the effects of dietary supplementation with capsaicinoids on the performance and gene expression of broilers. At 18 days of age, 120 male broilers chickens (Cobb 500) were distributed in a completely randomized design with three treatments, eight replicates, and five birds per experimental unit. The treatments were a basal diet or basal diet with the addition of 1 or 2 mg of capsaicinoids/kg of diet. The birds had free access to water and feed throughout the experimental period (18 to 26 days of age). Broiler performance was evaluated at 26 days of age, and one bird per experimental unit was selected to collect serum and jejunum samples. Jejunum samples were used to analyze the mRNA content. Data were analyzed using one-way ANOVA, and the means were compared with Tukey&#x2019;s test at a significance of 0.05. There was no effect of capsaicinoid supplementation on performance, serum metabolites, or the expression of glutathione peroxidase mRNA in the jejunum of broilers. However, broilers supplemented with capsaicinoids showed a higher mRNA expression of Cu, Zn-superoxide dismutase and a reduced mRNA expression of nuclear factor-&#x3BA;B in the jejunum. Supplementation with 1 and 2 mg/kg capsaicinoids <italic>did</italic> not improve the performance of broilers from 18 to 26 days of age but increased the mRNA expression of Cu, Zn-superoxide dismutase and reduced the mRNA expression of nuclear factor-&#x3BA;B in the jejunum of broilers.</p></abstract>
<kwd-group xml:lang="en">
<title>Keywords:</title>
<kwd>antioxidant</kwd>
<kwd>capsaicin</kwd>
<kwd>poultry</kwd>
</kwd-group>
<counts>
<fig-count count="1"/>
<table-count count="4"/>
<equation-count count="1"/>
<ref-count count="20"/></counts></article-meta></front>
<body>
<sec sec-type="intro">
<title>1. Introduction</title>
<p>Reactive oxygen species (ROS) are normally produced in mitochondria during aerobic cellular metabolism. However, oxidative stress in cells/tissues results from an imbalance between free radical production and endogenous antioxidant defense and leads to lipid peroxidation, protein nitration, DNA damage, and apoptosis (<xref ref-type="bibr" rid="B11">Mishra and Jha, 2019</xref>).</p>
<p>Oxidative stress homeostasis is one of the pillars of gut health maintenance and good productive performance of broilers (<xref ref-type="bibr" rid="B2">Chalvon-Demersay et al., 2021</xref>). However, in farming conditions, broilers are exposed to several environmental, technological, chemical, and nutritional stressors, resulting in potential oxidative stress and dysfunction of gut barrier and transport function (<xref ref-type="bibr" rid="B13">Patra, 2020</xref>), thus limiting their productive potential (<xref ref-type="bibr" rid="B1">Bacou et al., 2021</xref>). Factors such as thermal stress, mycotoxins, and lipopolysaccharide exposure can induce excessive activation of nuclear factor-&#x3BA;B (NF-&#x3BA;B) and lead to detrimental consequences, including chronic inflammation, compromised health status, and decreased productive performance (<xref ref-type="bibr" rid="B17">Surai et al., 2021</xref>).</p>
<p>Natural plant bioactives and antioxidants can be important alternatives to improve poultry production and gut health, including antioxidant stress and transport function (<xref ref-type="bibr" rid="B13">Patra, 2020</xref>; <xref ref-type="bibr" rid="B20">Xue et al., 2020</xref>). Capsaicinoids are secondary metabolites responsible for the strong and hot taste of pepper fruits that are known for their pungency (<xref ref-type="bibr" rid="B7">Hern&#xE1;ndez-P&#xE9;rez et al., 2020</xref>). Capsaicin and dehydrocapsaicin are the predominant molecules, representing approximately 90% of the total capsaicinoids, and other compounds, such as nordihydrocapsaicin, homocapsaicin and homodihydrocapsaicin, are also present in minor amounts (<xref ref-type="bibr" rid="B4">Giuffrida et al., 2013</xref>). Previous studies have indicated that supplementation with a combination of plant essential oils, including capsaicinoids, improves the intestinal health, antioxidative status, and performance of broilers (<xref ref-type="bibr" rid="B8">Karadas et al., 2014</xref>; <xref ref-type="bibr" rid="B14">Pirgozliev et al., 2019</xref>; <xref ref-type="bibr" rid="B20">Xue et al., 2020</xref>). However, studies are needed to investigate the effects of isolated capsaicinoid supplementation.</p>
<p>In this study, we hypothesized that capsaicinoids have antioxidant effects and that their dietary supplementation can improve broiler performance. Therefore, we aimed to evaluate the effects of dietary supplementation with a source of capsaicinoids on the performance and gene expression of broilers.</p>
</sec>
<sec sec-type="materials|methods">
<title>2. Material and Methods</title>
<sec>
<title>2.1. Ethical matters</title>
<p>The Institutional Animal Care and Use Committee approved all animal handling procedures (case number 08/2020), and the experiment was conducted according to the experimental protocol for the use of live birds from the Brazilian College of Animal Experimentation.</p>
</sec>
<sec>
<title>2.2. Birds, experimental design, and diets</title>
<p>The experiment was conducted in Vi&#xE7;osa, MG, Brazil (20&#xB0;45&#x27;57.19&#x22; S, 42&#xB0;51&#x27;35.42&#x22; W, and 682 m altitude). Male broiler chickens (Cobb 500) used in the experiment were obtained from a commercial hatchery (Rivelli Alimentos SA, Matheus Leme, MG, Brazil), and they were vaccinated against bursal disease and Marek&#x2019;s disease (Serotype 3, Live Marek&#x2019;s Disease Vector, Merial Inc., Athens, GA). From one day of age until the beginning of the experiment, the birds were reared on floor pens (200 &#xD7; 100 cm) equipped with two nipple drinkers and a feed dispenser. They had free access to water and were fed <italic>ad libitum</italic> with a corn/soybean meal-based diet in mashed form that was formulated to meet the nutritional recommendations of <xref ref-type="bibr" rid="B15">Rostagno et al. (2017)</xref>.</p>
<p>At 18 days of age, a total of 120 male broilers were assigned based on their body weight to a completely randomized experimental design with three treatments, eight repetitions, and five birds per experimental unit. The birds were housed in 24 experimental units consisting of wire cages (600 cm<sup>2</sup>/bird) in a four-level battery equipped with a trough feeder and a nipple drinker.</p>
<p>The treatments were a basal diet or a basal diet with the addition of 1 or 2 mg of capsaicinoids/kg of diet. The corn/soybean meal basal diet was formulated to meet the nutritional recommendations of <xref ref-type="bibr" rid="B15">Rostagno et al. (2017</xref>; <xref ref-type="table" rid="t1">Table 1</xref>). The source of capsaicinoids used was Capcin<sup>&#xAE;</sup> (ID4Feed, France), which had a concentration of 5 g capsaicinoids/kg; this product was used at a concentration of 200 and 400 mg/kg of basal diet. The diets were prepared in mashed form. The birds had free access to water and feed throughout the experimental period (18 to 26 days of age).</p>
<table-wrap id="t1">
<label>Table 1</label>
<caption>
<title>Ingredients and nutrient composition of the basal diet (as fed basis)</title></caption>
<table frame="hsides" rules="groups">
<colgroup width="49%">
<col width="1%"/>
<col/>
<col/>
</colgroup>
<thead style="border-top: thin solid; border-bottom: thin solid; border-color: #000000">
<tr>
<th align="left" valign="middle" colspan="2">Ingredient (g/kg)</th>
<th align="center" valign="middle">18-26 days of age</th>
</tr>
</thead>
<tbody style="border-bottom: thin solid; border-color: #000000">
<tr>
<td align="left" valign="middle"/>
<td align="left" valign="middle">Corn</td>
<td align="center" valign="middle">609.8</td>
</tr>
<tr>
<td align="left" valign="middle"/>
<td align="left" valign="middle">Soybean meal</td>
<td align="center" valign="middle">311.8</td>
</tr>
<tr>
<td align="left" valign="middle"/>
<td align="left" valign="middle">Soybean oil</td>
<td align="center" valign="middle">41.1</td>
</tr>
<tr>
<td align="left" valign="middle"/>
<td align="left" valign="middle">Dicalcium phosphate</td>
<td align="center" valign="middle">15.0</td>
</tr>
<tr>
<td align="left" valign="middle"/>
<td align="left" valign="middle">Limestone</td>
<td align="center" valign="middle">7.2</td>
</tr>
<tr>
<td align="left" valign="middle"/>
<td align="left" valign="middle">Salt</td>
<td align="center" valign="middle">4.9</td>
</tr>
<tr>
<td align="left" valign="middle"/>
<td align="left" valign="middle">DL-Methionine, 999 g/kg</td>
<td align="center" valign="middle">3.1</td>
</tr>
<tr>
<td align="left" valign="middle"/>
<td align="left" valign="middle">L-Lysine HCl, 780 g/kg</td>
<td align="center" valign="middle">2.8</td>
</tr>
<tr>
<td align="left" valign="middle"/>
<td align="left" valign="middle">Vitamin premix<xref ref-type="table-fn" rid="TFN1">1</xref></td>
<td align="center" valign="middle">1.2</td>
</tr>
<tr>
<td align="left" valign="middle"/>
<td align="left" valign="middle">Trace mineral premix<xref ref-type="table-fn" rid="TFN2">2</xref></td>
<td align="center" valign="middle">1.0</td>
</tr>
<tr>
<td align="left" valign="middle"/>
<td align="left" valign="middle">L-Threonine, 985 g/kg</td>
<td align="center" valign="middle">0.9</td>
</tr>
<tr>
<td align="left" valign="middle"/>
<td align="left" valign="middle">L-Valine, 990 g/kg</td>
<td align="center" valign="middle">0.7</td>
</tr>
<tr>
<td align="left" valign="middle"/>
<td align="left" valign="middle">Choline chloride, 600 g/kg</td>
<td align="center" valign="middle">0.5</td>
</tr>
<tr>
<td align="left" valign="middle" colspan="3">Calculated composition (g/kg, unless shown)</td>
</tr>
<tr>
<td align="left" valign="middle"/>
<td align="left" valign="middle">Metabolizable energy (MJ/kg)</td>
<td align="center" valign="middle">13.18</td>
</tr>
<tr>
<td align="left" valign="middle"/>
<td align="left" valign="middle">Crude protein</td>
<td align="center" valign="middle">195.0</td>
</tr>
<tr>
<td align="left" valign="middle"/>
<td align="left" valign="middle">Calcium</td>
<td align="center" valign="middle">7.5</td>
</tr>
<tr>
<td align="left" valign="middle"/>
<td align="left" valign="middle">Available phosphorous</td>
<td align="center" valign="middle">3.7</td>
</tr>
<tr>
<td align="left" valign="middle"/>
<td align="left" valign="middle">Sodium</td>
<td align="center" valign="middle">2.1</td>
</tr>
<tr>
<td align="left" valign="middle"/>
<td align="left" valign="middle">Digestible lysine</td>
<td align="center" valign="middle">11.2</td>
</tr>
<tr>
<td align="left" valign="middle"/>
<td align="left" valign="middle">Digestible methionine + cysteine</td>
<td align="center" valign="middle">8.3</td>
</tr>
<tr>
<td align="left" valign="middle"/>
<td align="left" valign="middle">Digestible valine</td>
<td align="center" valign="middle">8.7</td>
</tr>
<tr>
<td align="left" valign="middle"/>
<td align="left" valign="middle">Digestible threonine</td>
<td align="center" valign="middle">7.4</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn id="TFN1"><label>1</label><p>Vitamin premix provided per kg of diet: vitamin A, 11,564 IU; vitamin D3, 2891 IU; vitamin E, 43.3 IU; vitamin K3, 2.32 mg; vitamin B1, 3.11 mg; vitamin B12, 0.019 mg; vitamin B6, 4.33 mg; vitamin B5, 15.5 mg; vitamin B3, 47.0 mg; vitamin B9, 1.08 mg; biotin, 0.11 mg.</p></fn>
<fn id="TFN2"><label>2</label><p>Trace mineral premix provided per kg of diet: Mn, 58.36 mg; Zn, 54.21 mg; Fe, 41.68 mg; Cu, 8.31 mg; I, 0.843 mg; Se, 0.250 mg.</p></fn>
</table-wrap-foot></table-wrap>
<p>The ambient temperature was maintained at 22 &#xB0;C and the birds were exposed to 18 h of continuous light daily during the experimental period.</p>
</sec>
<sec>
<title>2.3. Performance and sample collection</title>
<p>Broiler performance was evaluated at 26 days of age by determining body weight gain (BWG), feed intake (FI), and feed conversion rate (FCR).</p>
<p>At 26 days of age, one male bird with a weight closest to the average weight of the experimental unit was selected for sample collection. Blood was collected from this bird through the wing vein. The blood was centrifuged at 3,600 &#xD7; <italic>g</italic> at 4 &#xB0;C for 10 min for separation; serum samples were stored at &#x2212;20 &#xB0;C until analysis. After blood collection, the bird was euthanized by cervical displacement. Samples of the jejunum of 2 cm in length were collected, stored individually in cryogenic tubes, and then placed in liquid nitrogen. Subsequently, they were transferred to freezer storage at &#x2212;80 &#xB0;C until the RNA extraction process.</p>
</sec>
<sec>
<title>2.4. Serum parameter measurements</title>
<p>The collected blood was used to analyze serum levels of glucose, triglycerides, cholesterol, high-density lipoprotein (HDL), low-density lipoprotein (LDL), and very low-density lipoprotein (VLDL; Cobas c 311; Roche Diagnostics GmbH, Basel, Switzerland) following the manufacturer&#x2019;s instructions. To measure the serum level of malondialdehyde (MDA), 2.5 mL of 20% trichloroacetic acid and 1.0 mL of 0.67% thiobarbituric acid were added to 0.5 mL of serum, and the mixture was heated for 30 min in boiling water. The resulting chromogen was extracted with 4.0 mL of n-butyl alcohol. The absorbance of the organic phase was determined at a wavelength of 530 nm.</p>
</sec>
<sec>
<title>2.5. Determination of mRNA content</title>
<p>Total RNA was extracted from 50 mg of jejunum samples using TRIzol<sup>&#xAE;</sup> (Invitrogen, Carlsbad, CA, USA) according to the manufacturer&#x2019;s instructions. The resulting precipitate was rehydrated with 25 &#x3BC;L of UltraPure DNase/RNase-Free water. RNA concentration was estimated using a NanoDrop<sup>TM</sup> Lite Spectrophotometer (Thermo Fisher Scientific, Beverly, MA, USA), and RNA integrity was determined in a 1.0% agarose gel. The first cDNA strand was synthesized using High-Capacity cDNA Reverse Transcription Kits (Applied Biosystems, Thermo Fisher Scientific, Beverly, MA, USA). The primer sets used are shown in <xref ref-type="table" rid="t2">Table 2</xref>. &#x3B2;-actin was used as the reference gene for data normalization because of its higher expression and stability. The following target genes were assessed: nuclear factor-&#x3BA;B (NF-&#x3BA;B), glutathione peroxidase (GPX), and Cu, Zn-superoxide dismutase (SOD1). The RT-qPCR analyses were performed in duplicate using Applied Biosystems&#x2122; QuantStudio Real-Time PCR Systems (Applied Biosystems, Thermo Fisher Scientific, Beverly, MA, USA) with the relative quantification method, and applying the SYBR<sup>&#xAE;</sup> Green system (Applied Biosystems - Foster City, CA, USA) and the GoTaq<sup>&#xAE;</sup> qPCR Master Mix kit (Promega Corporation, Madison, USA). Polymerase chain reactions were conducted using the following the program: 95 &#xB0;C for 2 min, followed by 40 cycles of 95 &#xB0;C for 15 s, and 60 &#xB0;C for 1 min. The threshold cycle (Ct) values obtained were later normalized (&#x394;Ct) based on the Ct values of the endogenous control gene &#x3B2;-ACT. The calculation of the relative gene expression levels was performed according to the 2<sup>&#x2212;&#x394;Ct</sup> method described by <xref ref-type="bibr" rid="B10">Livak and Schmittgen (2001)</xref>.</p>
<table-wrap id="t2">
<label>Table 2</label>
<caption>
<title>Primer sequences</title></caption>
<table frame="hsides" rules="groups">
<colgroup width="33%">
<col/>
<col/>
<col/>
</colgroup>
<thead style="border-top: thin solid; border-bottom: thin solid; border-color: #000000">
<tr>
<th align="left" valign="middle">Gene</th>
<th align="center" valign="middle">Forward sequence</th>
<th align="center" valign="middle">Reverse sequence</th>
</tr>
</thead>
<tbody style="border-bottom: thin solid; border-color: #000000">
<tr>
<td align="left" valign="middle"><italic>NF-&#x3BA;B</italic></td>
<td align="center" valign="middle">GTGTGAAGAAACGGGAACTG</td>
<td align="center" valign="middle">GGCACGGTTGTCATAGATGG</td>
</tr>
<tr>
<td align="left" valign="middle"><italic>GPX</italic></td>
<td align="center" valign="middle">GACCAACCCGCAGTACATCA</td>
<td align="center" valign="middle">GAGGTGCGGGCTTTCCTTTA</td>
</tr>
<tr>
<td align="left" valign="middle"><italic>SOD1</italic></td>
<td align="center" valign="middle">AGGGGGTCATCCACTTCC</td>
<td align="center" valign="middle">CCCATTTGTGTTGTCTCCAA</td>
</tr>
<tr>
<td align="left" valign="middle"><italic>&#x3B2;-actin</italic></td>
<td align="center" valign="middle">TGCTGTGTTCCCATCTATCG</td>
<td align="center" valign="middle">TTGGTGACAATACCGTGTTCA</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn id="TFN3"><p><italic>NF-&#x3BA;B</italic> - nuclear factor-&#x3BA;B; <italic>GPX</italic> - glutathione peroxidase; <italic>SOD1</italic> - Cu, Zn-superoxide dismutase.</p></fn>
</table-wrap-foot></table-wrap>
</sec>
<sec>
<title>2.6. Statistical analysis</title>
<p>For each variable, the analysis of variance was performed according to the following general model:</p>
<disp-formula id="eq1"><mml:math id="m1" display="block"><mml:msub><mml:mtext>Y</mml:mtext><mml:mrow><mml:mtext>ij</mml:mtext></mml:mrow></mml:msub><mml:mo>=</mml:mo><mml:mtext>&#x3BC;&#x2009;+&#x2009;</mml:mtext><mml:msub><mml:mtext>&#x3B1;</mml:mtext><mml:mtext>i</mml:mtext></mml:msub><mml:mo>+</mml:mo><mml:msub><mml:mtext>&#x3B5;</mml:mtext><mml:mrow><mml:mtext>ij</mml:mtext></mml:mrow></mml:msub><mml:mo>,</mml:mo></mml:math></disp-formula>
<p>in which Y<sub>ij</sub> is the measured dependent variable, &#x3BC; is the overall mean, &#x3B1;<sub>i</sub> is the effect of treatments, and &#x3B5;<sub>ij</sub> is the random error.</p>
<p>The average FI and BWG of the five birds in each cage were considered for the statistical analysis of the growth performance variables. For serum and mRNA expression analyses, one bird per replicate was considered the experimental unit. Analysis of variance for each variable was performed under a completely randomized design using the GLM procedure of SAS (Statistical Analysis System, 9.4). The analysis of variance assumptions given by normality of residuals and homogeneity of variances were evaluated using the Shapiro-Wilk and Hartley tests, respectively. For the mRNA expression of GPX and SOD1, since the analysis of variance assumptions were not verified, the original data were transformed by Box-Cox transformation. The comparisons between the means of treatments were performed through Tukey&#x2019;s test, considering a 5% probability of type I error.</p>
</sec>
</sec>
<sec sec-type="results">
<title>3. Results</title>
<sec>
<title>3.1. Performance</title>
<p>There was no effect of capsaicinoid supplementation on the performance of broilers from 18 to 26 days of age (P&#x3E;0.05; <xref ref-type="table" rid="t3">Table 3</xref>).</p>
<table-wrap id="t3">
<label>Table 3</label>
<caption>
<title>Growth performance of broilers from 18 to 26 days of age</title></caption>
<table frame="hsides" rules="groups">
<colgroup width="16%">
<col/>
<col/>
<col/>
<col/>
<col/>
<col/>
</colgroup>
<thead style="border-top: thin solid; border-bottom: thin solid; border-color: #000000">
<tr>
<th align="center" valign="middle" rowspan="2"/>
<th align="center" valign="middle" colspan="3" style="border-bottom: thin solid; border-color: #000000">Capsaicinoids (mg/kg of diet)</th>
<th align="center" valign="middle" rowspan="2">SEM</th>
<th align="center" valign="middle" rowspan="2">P-value</th>
</tr>
<tr>
<th align="center" valign="middle">0</th>
<th align="center" valign="middle">1</th>
<th align="center" valign="middle">2</th>
</tr>
</thead>
<tbody style="border-bottom: thin solid; border-color: #000000">
<tr>
<td align="left" valign="middle">IBW (kg)</td>
<td align="center" valign="middle">0.652</td>
<td align="center" valign="middle">0.651</td>
<td align="center" valign="middle">0.651</td>
<td align="center" valign="middle">0.002</td>
<td align="center" valign="middle">0.944</td>
</tr>
<tr>
<td align="left" valign="middle">BWG (kg/bird/day)</td>
<td align="center" valign="middle">0.076</td>
<td align="center" valign="middle">0.078</td>
<td align="center" valign="middle">0.077</td>
<td align="center" valign="middle">0.001</td>
<td align="center" valign="middle">0.338</td>
</tr>
<tr>
<td align="left" valign="middle">FI (kg/bird/day)</td>
<td align="center" valign="middle">0.119</td>
<td align="center" valign="middle">0.122</td>
<td align="center" valign="middle">0.116</td>
<td align="center" valign="middle">0.001</td>
<td align="center" valign="middle">0.392</td>
</tr>
<tr>
<td align="left" valign="middle">FCR</td>
<td align="center" valign="middle">1.56</td>
<td align="center" valign="middle">1.56</td>
<td align="center" valign="middle">1.51</td>
<td align="center" valign="middle">0.03</td>
<td align="center" valign="middle">0.691</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn id="TFN4"><p>IBW - initial body weight; BWG - body weight gain; FI - feed intake; FCR - feed conversion ratio; SEM - standard error of the means (n = 8 for treatment).</p></fn>
</table-wrap-foot></table-wrap>
</sec>
<sec>
<title>3.2. Serum metabolites</title>
<p>There was no effect of treatment on serum levels of glucose, triglycerides, cholesterol, HDL, LDL, VLDL, or MDA (P&#x3E;0.05; <xref ref-type="table" rid="t4">Table 4</xref>).</p>
<table-wrap id="t4">
<label>Table 4</label>
<caption>
<title>Serum metabolites of broilers at 26 days of age</title></caption>
<table frame="hsides" rules="groups">
<colgroup width="16%">
<col/>
<col/>
<col/>
<col/>
<col/>
<col/>
</colgroup>
<thead style="border-top: thin solid; border-bottom: thin solid; border-color: #000000">
<tr>
<th align="center" valign="middle" rowspan="2"/>
<th align="center" valign="middle" colspan="3" style="border-bottom: thin solid; border-color: #000000">Capsaicinoids (mg/kg of diet)</th>
<th align="center" valign="middle" rowspan="2">SEM</th>
<th align="center" valign="middle" rowspan="2">P-value</th>
</tr>
<tr>
<th align="center" valign="middle">0</th>
<th align="center" valign="middle">1</th>
<th align="center" valign="middle">2</th>
</tr>
</thead>
<tbody style="border-bottom: thin solid; border-color: #000000">
<tr>
<td align="left" valign="middle">Glucose (mg/dL)</td>
<td align="center" valign="middle">246.0</td>
<td align="center" valign="middle">242.3</td>
<td align="center" valign="middle">250.6</td>
<td align="center" valign="middle">2.7</td>
<td align="center" valign="middle">0.473</td>
</tr>
<tr>
<td align="left" valign="middle">Triglycerides (mg/dL)</td>
<td align="center" valign="middle">87.8</td>
<td align="center" valign="middle">99.3</td>
<td align="center" valign="middle">101.1</td>
<td align="center" valign="middle">5.6</td>
<td align="center" valign="middle">0.598</td>
</tr>
<tr>
<td align="left" valign="middle">Cholesterol (mg/dL)</td>
<td align="center" valign="middle">119.8</td>
<td align="center" valign="middle">119.5</td>
<td align="center" valign="middle">119.1</td>
<td align="center" valign="middle">2.4</td>
<td align="center" valign="middle">0.995</td>
</tr>
<tr>
<td align="left" valign="middle">HDL (mg/dL)</td>
<td align="center" valign="middle">79.8</td>
<td align="center" valign="middle">79.9</td>
<td align="center" valign="middle">77.6</td>
<td align="center" valign="middle">1.6</td>
<td align="center" valign="middle">0.822</td>
</tr>
<tr>
<td align="left" valign="middle">LDL (mg/dL)</td>
<td align="center" valign="middle">22.5</td>
<td align="center" valign="middle">19.8</td>
<td align="center" valign="middle">21.3</td>
<td align="center" valign="middle">1.3</td>
<td align="center" valign="middle">0.710</td>
</tr>
<tr>
<td align="left" valign="middle">VLDL (mg/dL)</td>
<td align="center" valign="middle">17.6</td>
<td align="center" valign="middle">19.9</td>
<td align="center" valign="middle">20.2</td>
<td align="center" valign="middle">1.1</td>
<td align="center" valign="middle">0.598</td>
</tr>
<tr>
<td align="left" valign="middle">Malondialdehyde (nmol/mL)</td>
<td align="center" valign="middle">3.15</td>
<td align="center" valign="middle">2.95</td>
<td align="center" valign="middle">2.90</td>
<td align="center" valign="middle">0.13</td>
<td align="center" valign="middle">0.740</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn id="TFN5"><p>HDL - high-density lipoprotein; LDL - low-density lipoprotein; VLDL - very low-density lipoprotein; SEM - standard error of the means (n = 8 for treatment).</p></fn>
</table-wrap-foot></table-wrap>
</sec>
<sec>
<title>3.3. mRNA content</title>
<p>Broilers supplemented with 1 and 2 mg/kg capsaicinoids showed higher mRNA expression of SOD1 (P&#x3C;0.001) in the jejunum compared with birds fed the basal diet (<xref ref-type="fig" rid="f1">Figure 1</xref>). However, the mRNA expression of GPX (P&#x3E;0.05) was not influenced by the treatments. The capsaicinoid supplementation of 2 mg/kg reduced the mRNA expression of NF-&#x3BA;B (P = 0.031) in the jejunum of broilers compared with the basal diet.</p>
<fig id="f1">
<label>Figure 1</label>
<caption>
<title>The mRNA expression of Cu,Zn-superoxide dismutase (<italic>SOD1</italic>), glutathione peroxidase (<italic>GPX</italic>), and nuclear factor-&#x3BA;B (<italic>NF-&#x3BA;B</italic>) in the jejunum of broilers at 26 days of age in response to the addition of 0, 1 or 2 mg capsaicinoids/kg of diet.</title></caption>
<graphic xlink:href="1806-9290-rbz-51-e20220077-gf01.tif"/>
<attrib>Means (+ standard error of mean) are shown. n = 8 per treatment. <italic>SOD1</italic>, P&#x3C;0.001; <italic>GPX</italic>, P = 0.193; <italic>NF-&#x3BA;B</italic>, P = 0.031.</attrib>
</fig>
</sec>
</sec>
<sec sec-type="discussion">
<title>4. Discussion</title>
<p>In this study, we hypothesized that capsaicinoids have antioxidant effects in broilers. In fact, supplementation with 1 or 2 mg capsaicinoids/kg of diet improved the expression of SOD1 in the jejunum. Superoxide dismutase is part of the antioxidant enzyme system, and the increase in its activity in response to exogenous antioxidants has been associated with the removal of ROS from cells (<xref ref-type="bibr" rid="B19">Winiarska-Mieczan et al., 2021</xref>). Another important finding in the present study was the reduction in the mRNA expression of NF-&#x3BA;B in the jejunum of broilers supplemented with 2 mg capsaicinoids/kg of diet. The regulatory roles of NF-&#x3BA;B in poultry are still poorly understood, but the available information indicates that, similar to its role in mammals, it is a main regulator of many processes, including inflammation (<xref ref-type="bibr" rid="B17">Surai et al., 2021</xref>). Several stress signals have been associated with increased NF-&#x3BA;B, including ROS (<xref ref-type="bibr" rid="B16">Sivandzade et al., 2019</xref>). Recently, <xref ref-type="bibr" rid="B9">Liu et al. (2021)</xref> also observed an influence of capsaicinoids on the antioxidant status of broilers. The authors observed that birds supplemented with 80 mg/kg natural capsaicin extract had higher levels of serum total antioxidant capacity and SOD and lower levels of the proinflammatory cytokines interleukin-1&#x3B2; and tumor necrosis factor-&#x3B1;.</p>
<p>Malondialdehyde is a marker of lipid peroxidation, and higher levels are due to oxidative stress in the body (<xref ref-type="bibr" rid="B3">Ghasemi-Sadabadi et al., 2020</xref>). However, despite the above results, supplementation with capsaicinoids did not influence the serum concentration of MDA or other evaluated metabolites. In contrast to the results observed in the present study, supplementation with hot red pepper oil decreased the plasma levels of triglycerides, cholesterol, and LDL (<xref ref-type="bibr" rid="B9">Liu et al., 2021</xref>; <xref ref-type="bibr" rid="B6">Hassan et al., 2022</xref>).</p>
<p>In the present study, capsaicinoid supplementation did not improve the performance of broilers, and this finding was different from previous reports. <xref ref-type="bibr" rid="B5">Hassan and El-Ktany (2020)</xref> observed that the supplementation of 0.25 to 1 mL/kg of hot red pepper oil improved the weight gain and FCR of broilers. <xref ref-type="bibr" rid="B18">Thiamhirunsopit et al. (2014)</xref> also observed improvements in the weight gain and FCR of broilers fed a diet containing 20 mg/kg capsaicin. The positive effect on performance may be associated with the antioxidant capacities and anti-inflammatory activities of capsaicinoids (<xref ref-type="bibr" rid="B12">Nascimento et al., 2013</xref>). In addition, <xref ref-type="bibr" rid="B9">Liu et al. (2021)</xref> associated the better performance with enhanced growth hormone levels observed in broilers fed diets containing natural capsaicin extract. The lack of positive results on the performance in the present study may be due to the short experimental period that limited the response time of the birds.</p>
</sec>
<sec sec-type="conclusions">
<title>5. Conclusions</title>
<p>Supplementation with 1 and 2 mg/kg capsaicinoids did not improve the performance of broilers from 18 to 26 days of age but increased the mRNA expression of SOD1 and reduced the mRNA expression of NF-&#x3BA;B in the jejunum of broilers.</p>
</sec>
</body>
<back>
<ack>
<title>Acknowledgments</title>
<p>This work has been supported by the following Brazilian research agencies: Conselho Nacional de Desenvolvimento Cient&#xED;fico e Tecnol&#xF3;gico (CNPq) and Coordena&#xE7;&#xE3;o de Aperfei&#xE7;oamento de Pessoal de N&#xED;vel Superior (CAPES).</p>
</ack>
<ref-list>
<title>References</title>
<ref id="B1">
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Bacou</surname><given-names>E.</given-names></name>
<name><surname>Walk</surname><given-names>C.</given-names></name>
<name><surname>Rider</surname><given-names>S.</given-names></name>
<name><surname>Litta</surname><given-names>G.</given-names></name>
<name><surname>Perez-Calvo</surname><given-names>E.</given-names></name>
</person-group>
<year>2021</year>
<article-title>Dietary oxidative distress: a review of nutritional challenges as models for poultry, swine and fish</article-title>
<source>Antioxidants</source>
<volume>10</volume>
<fpage>525</fpage>
<lpage>525</lpage>
<comment><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3390/antiox10040525">https://doi.org/10.3390/antiox10040525</ext-link></comment></element-citation>
<mixed-citation>Bacou, E.; Walk, C.; Rider, S.; Litta, G. and Perez-Calvo, E. 2021. Dietary oxidative distress: a review of nutritional challenges as models for poultry, swine and fish. Antioxidants 10:525. https://doi.org/10.3390/antiox10040525</mixed-citation></ref>
<ref id="B2">
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Chalvon-Demersay</surname><given-names>T.</given-names></name>
<name><surname>Luise</surname><given-names>D.</given-names></name>
<name><surname>Le Floc&#x2019;h</surname><given-names>N.</given-names></name>
<name><surname>Tesseraud</surname><given-names>S.</given-names></name>
<name><surname>Lambert</surname><given-names>W.</given-names></name>
<name><surname>Bosi</surname><given-names>P.</given-names></name>
<name><surname>Trevisi</surname><given-names>P.</given-names></name>
<name><surname>Beaumont</surname><given-names>M.</given-names></name>
<name><surname>Corrent</surname><given-names>E.</given-names></name>
</person-group>
<year>2021</year>
<article-title>Functional amino acids in pigs and chickens: implication for gut health</article-title>
<source>Frontiers in Veterinary Science</source>
<volume>8</volume>
<fpage>663727</fpage>
<lpage>663727</lpage>
<comment><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3389/fvets.2021.663727">https://doi.org/10.3389/fvets.2021.663727</ext-link></comment></element-citation>
<mixed-citation>Chalvon-Demersay, T.; Luise, D.; Le Floc&#x2019;h, N.; Tesseraud, S.; Lambert, W.; Bosi, P.; Trevisi, P.; Beaumont, M. and Corrent, E. 2021. Functional amino acids in pigs and chickens: implication for gut health. Frontiers in Veterinary Science 8:663727. https://doi.org/10.3389/fvets.2021.663727</mixed-citation></ref>
<ref id="B3">
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Ghasemi-Sadabadi</surname><given-names>M.</given-names></name>
<name><surname>Veldkamp</surname><given-names>T.</given-names></name>
<name><surname>van Krimpen</surname><given-names>M.</given-names></name>
<name><surname>Ebrahimnezhad</surname><given-names>Y.</given-names></name>
<name><surname>Ghalehkandi</surname><given-names>J. G.</given-names></name>
<name><surname>Salehi</surname><given-names>A.</given-names></name>
<name><surname>Didehvar</surname><given-names>M.</given-names></name>
<name><surname>Khodaei</surname><given-names>M.</given-names></name>
<name><surname>Mehdizadeh</surname><given-names>A.</given-names></name>
</person-group>
<year>2020</year>
<article-title>Determining tolerance of Japanese quail to different dietary fat peroxidation values by supplementation with Rosemary and Aloe Vera on performance and meat quality</article-title>
<source>Animal Feed Science and Technology</source>
<volume>267</volume>
<fpage>114574</fpage>
<lpage>114574</lpage>
<comment><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1016/j.anifeedsci.2020.114574">https://doi.org/10.1016/j.anifeedsci.2020.114574</ext-link></comment></element-citation>
<mixed-citation>Ghasemi-Sadabadi, M.; Veldkamp, T.; van Krimpen, M.; Ebrahimnezhad, Y.; Ghalehkandi, J. G.; Salehi, A.; Didehvar, M.; Khodaei, M. and Mehdizadeh, A. 2020. Determining tolerance of Japanese quail to different dietary fat peroxidation values by supplementation with Rosemary and Aloe Vera on performance and meat quality. Animal Feed Science and Technology 267:114574. https://doi.org/10.1016/j.anifeedsci.2020.114574</mixed-citation></ref>
<ref id="B4">
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Giuffrida</surname><given-names>D.</given-names></name>
<name><surname>Dugo</surname><given-names>P.</given-names></name>
<name><surname>Torre</surname><given-names>G.</given-names></name>
<name><surname>Bignardi</surname><given-names>C.</given-names></name>
<name><surname>Cavazza</surname><given-names>A.</given-names></name>
<name><surname>Corradini</surname><given-names>C.</given-names></name>
<name><surname>Dugo</surname><given-names>G.</given-names></name>
</person-group>
<year>2013</year>
<article-title>Characterization of 12 <italic>Capsicum</italic> varieties by evaluation of their carotenoid profile and pungency determination</article-title>
<source>Food Chemistry</source>
<volume>140</volume>
<fpage>794</fpage>
<lpage>802</lpage>
<comment><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1016/j.foodchem.2012.09.060">https://doi.org/10.1016/j.foodchem.2012.09.060</ext-link></comment></element-citation>
<mixed-citation>Giuffrida, D.; Dugo, P.; Torre, G.; Bignardi, C.; Cavazza, A.; Corradini, C. and Dugo, G. 2013. Characterization of 12 <italic>Capsicum</italic> varieties by evaluation of their carotenoid profile and pungency determination. Food Chemistry 140:794-802. https://doi.org/10.1016/j.foodchem.2012.09.060</mixed-citation></ref>
<ref id="B5">
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Hassan</surname><given-names>S. S. A.</given-names></name>
<name><surname>El-Ktany</surname><given-names>E. M.</given-names></name>
</person-group>
<year>2020</year>
<article-title>Effect of hot red pepper oil on the productivity, carcass characteristics and economic efficiency of broiler chickens</article-title>
<source>Journal of Animal Health and Production</source>
<volume>9</volume>
<issue>s1</issue>
<fpage>128</fpage>
<lpage>134</lpage>
<comment><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.17582/journal.jahp/2020/9.s1.128.134">https://doi.org/10.17582/journal.jahp/2020/9.s1.128.134</ext-link></comment></element-citation>
<mixed-citation>Hassan, S. S. A. and El-Ktany, E. M. 2020. Effect of hot red pepper oil on the productivity, carcass characteristics and economic efficiency of broiler chickens. Journal of Animal Health and Production 9(s1):128-134. https://doi.org/10.17582/journal.jahp/2020/9.s1.128.134</mixed-citation></ref>
<ref id="B6">
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Hassan</surname><given-names>S.</given-names></name>
<name><surname>Hassan</surname><given-names>M.</given-names></name>
<name><surname>Soliman</surname><given-names>F.</given-names></name>
<name><surname>Safwat</surname><given-names>A.</given-names></name>
</person-group>
<year>2022</year>
<article-title>Influence of hot red pepper oil in broiler diets on blood, antioxidant, immunological parameters and intestinal bacteria counts</article-title>
<source>Animal Biotechnology</source>
<comment><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1080/10495398.2021.2020132">https://doi.org/10.1080/10495398.2021.2020132</ext-link></comment></element-citation>
<mixed-citation>Hassan, S.; Hassan, M.; Soliman, F. and Safwat, A. 2022. Influence of hot red pepper oil in broiler diets on blood, antioxidant, immunological parameters and intestinal bacteria counts. Animal Biotechnology. https://doi.org/10.1080/10495398.2021.2020132</mixed-citation></ref>
<ref id="B7">
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Hern&#xE1;ndez-P&#xE9;rez</surname><given-names>T.</given-names></name>
<name><surname>G&#xF3;mez-Garc&#xED;a</surname><given-names>M. R.</given-names></name>
<name><surname>Valverde</surname><given-names>M. E.</given-names></name>
<name><surname>Paredes-L&#xF3;pez</surname><given-names>O.</given-names></name>
</person-group>
<year>2020</year>
<article-title><italic>Capsicum annuum</italic> (hot pepper): an ancient Latin-American crop with outstanding bioactive compounds and nutraceutical potential</article-title>
<source>A review. Comprehensive Reviews in Food Science and Food Safety</source>
<volume>19</volume>
<fpage>2972</fpage>
<lpage>2993</lpage>
<comment><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1111/1541-4337.12634">https://doi.org/10.1111/1541-4337.12634</ext-link></comment></element-citation>
<mixed-citation>Hern&#xE1;ndez-P&#xE9;rez, T.; G&#xF3;mez-Garc&#xED;a, M. R.; Valverde, M. E. and Paredes-L&#xF3;pez, O. 2020. <italic>Capsicum annuum</italic> (hot pepper): an ancient Latin-American crop with outstanding bioactive compounds and nutraceutical potential. A review. Comprehensive Reviews in Food Science and Food Safety 19:2972-2993. https://doi.org/10.1111/1541-4337.12634</mixed-citation></ref>
<ref id="B8">
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Karadas</surname><given-names>F.</given-names></name>
<name><surname>Pirgozliev</surname><given-names>V.</given-names></name>
<name><surname>Rose</surname><given-names>S. P.</given-names></name>
<name><surname>Dimitrov</surname><given-names>D.</given-names></name>
<name><surname>Oduguwa</surname><given-names>O.</given-names></name>
<name><surname>Bravo</surname><given-names>D.</given-names></name>
</person-group>
<year>2014</year>
<article-title>Dietary essential oils improve the hepatic antioxidative status of broiler chickens</article-title>
<source>British Poultry Science</source>
<volume>55</volume>
<fpage>329</fpage>
<lpage>334</lpage>
<comment><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1080/00071668.2014.891098">https://doi.org/10.1080/00071668.2014.891098</ext-link></comment></element-citation>
<mixed-citation>Karadas, F.; Pirgozliev, V.; Rose, S. P.; Dimitrov, D.; Oduguwa, O. and Bravo, D. 2014. Dietary essential oils improve the hepatic antioxidative status of broiler chickens. British Poultry Science 55:329-334. https://doi.org/10.1080/00071668.2014.891098</mixed-citation></ref>
<ref id="B9">
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Liu</surname><given-names>S. J.</given-names></name>
<name><surname>Wang</surname><given-names>J.</given-names></name>
<name><surname>He</surname><given-names>T. F.</given-names></name>
<name><surname>Liu</surname><given-names>H. S.</given-names></name>
<name><surname>Piao</surname><given-names>X. S.</given-names></name>
</person-group>
<year>2021</year>
<article-title>Effects of natural capsicum extract on growth performance, nutrient utilization, antioxidant status, immune function, and meat quality in broilers</article-title>
<source>Poultry Science</source>
<volume>100</volume>
<fpage>101301</fpage>
<lpage>101301</lpage>
<comment><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1016/j.psj.2021.101301">https://doi.org/10.1016/j.psj.2021.101301</ext-link></comment></element-citation>
<mixed-citation>Liu, S. J.; Wang, J.; He, T. F.; Liu, H. S. and Piao, X. S. 2021. Effects of natural capsicum extract on growth performance, nutrient utilization, antioxidant status, immune function, and meat quality in broilers. Poultry Science 100:101301. https://doi.org/10.1016/j.psj.2021.101301</mixed-citation></ref>
<ref id="B10">
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Livak</surname><given-names>K. J.</given-names></name>
<name><surname>Schmittgen</surname><given-names>T. D.</given-names></name>
</person-group>
<year>2001</year>
<article-title>Analysis of relative gene expression data using real-time quantitative PCR and the 2<sup>&#x2212;&#x394;&#x394;CT</sup> method</article-title>
<source>Methods</source>
<volume>25</volume>
<fpage>402</fpage>
<lpage>408</lpage>
<comment><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1006/meth.2001.1262">https://doi.org/10.1006/meth.2001.1262</ext-link></comment></element-citation>
<mixed-citation>Livak, K. J. and Schmittgen, T. D. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2<sup>&#x2212;&#x394;&#x394;CT</sup> method. Methods 25:402-408. https://doi.org/10.1006/meth.2001.1262</mixed-citation></ref>
<ref id="B11">
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Mishra</surname><given-names>B.</given-names></name>
<name><surname>Jha</surname><given-names>R.</given-names></name>
</person-group>
<year>2019</year>
<article-title>Oxidative stress in the poultry gut: potential challenges and interventions</article-title>
<source>Frontiers in Veterinary Science</source>
<volume>6</volume>
<fpage>60</fpage>
<lpage>60</lpage>
<comment><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3389/fvets.2019.00060">https://doi.org/10.3389/fvets.2019.00060</ext-link></comment></element-citation>
<mixed-citation>Mishra, B. and Jha, R. 2019. Oxidative stress in the poultry gut: potential challenges and interventions. Frontiers in Veterinary Science 6:60. https://doi.org/10.3389/fvets.2019.00060</mixed-citation></ref>
<ref id="B12">
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Nascimento</surname><given-names>P. L. A.</given-names></name>
<name><surname>Nascimento</surname><given-names>T. C. E. S</given-names></name>
<name><surname>Ramos</surname><given-names>N. S. M.</given-names></name>
<name><surname>Silva</surname><given-names>G. R.</given-names></name>
<name><surname>Camara</surname><given-names>C. A.</given-names></name>
<name><surname>Silva</surname><given-names>T. M. S.</given-names></name>
<name><surname>Moreira</surname><given-names>K. A.</given-names></name>
<name><surname>Porto</surname><given-names>A. L. F.</given-names></name>
</person-group>
<year>2013</year>
<article-title>Antimicrobial and antioxidant activities of Pimenta malagueta (<italic>Capsicum frutescens</italic>)</article-title>
<source>African Journal of Microbiology Research</source>
<volume>7</volume>
<fpage>3526</fpage>
<lpage>3533</lpage>
</element-citation>
<mixed-citation>Nascimento, P. L. A.; Nascimento, T. C. E. S.; Ramos, N. S. M.; Silva, G. R.; Camara, C. A.; Silva, T. M. S.; Moreira, K. A. and Porto, A. L. F. 2013. Antimicrobial and antioxidant activities of Pimenta malagueta (<italic>Capsicum frutescens</italic>). African Journal of Microbiology Research 7:3526-3533.</mixed-citation></ref>
<ref id="B13">
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Patra</surname><given-names>A. K.</given-names></name>
</person-group>
<year>2020</year>
<article-title>Influence of plant bioactive compounds on intestinal epithelial barrier in poultry</article-title>
<source>Mini-Reviews in Medicinal Chemistry</source>
<volume>20</volume>
<fpage>566</fpage>
<lpage>577</lpage>
<comment><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.2174/1389557520666191226111405">https://doi.org/10.2174/1389557520666191226111405</ext-link></comment></element-citation>
<mixed-citation>Patra, A. K. 2020. Influence of plant bioactive compounds on intestinal epithelial barrier in poultry. Mini-Reviews in Medicinal Chemistry 20:566-577. https://doi.org/10.2174/1389557520666191226111405</mixed-citation></ref>
<ref id="B14">
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Pirgozliev</surname><given-names>V.</given-names></name>
<name><surname>Mansbridge</surname><given-names>S. C.</given-names></name>
<name><surname>Rose</surname><given-names>S. P.</given-names></name>
<name><surname>Lillehoj</surname><given-names>H. S.</given-names></name>
<name><surname>Bravo</surname><given-names>D.</given-names></name>
</person-group>
<year>2019</year>
<article-title>Immune modulation, growth performance, and nutrient retention in broiler chickens fed a blend of phytogenic feed additives</article-title>
<source>Poultry Science</source>
<volume>98</volume>
<fpage>3443</fpage>
<lpage>3449</lpage>
<comment><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3382/ps/pey472">https://doi.org/10.3382/ps/pey472</ext-link></comment></element-citation>
<mixed-citation>Pirgozliev, V.; Mansbridge, S. C.; Rose, S. P.; Lillehoj, H. S. and Bravo, D. 2019. Immune modulation, growth performance, and nutrient retention in broiler chickens fed a blend of phytogenic feed additives. Poultry Science 98:3443-3449. https://doi.org/10.3382/ps/pey472</mixed-citation></ref>
<ref id="B15">
<element-citation publication-type="book">
<person-group person-group-type="author">
<name><surname>Rostagno</surname><given-names>H. S.</given-names></name>
<name><surname>Albino</surname><given-names>L. F. T.</given-names></name>
<name><surname>Hannas</surname><given-names>M. I.</given-names></name>
<name><surname>Donzele</surname><given-names>J. L.</given-names></name>
<name><surname>Sakomura</surname><given-names>N. K.</given-names></name>
<name><surname>Perazzo</surname><given-names>F. G.</given-names></name>
<name><surname>Saraiva</surname><given-names>A.</given-names></name>
<name><surname>Teixeira</surname><given-names>M. L.</given-names></name>
<name><surname>Rodrigues</surname><given-names>P. B.</given-names></name>
<name><surname>Oliveira</surname><given-names>R. F.</given-names></name>
<name><surname>Barreto</surname><given-names>S. L. T.</given-names></name>
<name><surname>Brito</surname><given-names>C. O.</given-names></name>
</person-group>
<year>2017</year>
<source>Tabelas Brasileiras para su&#xED;nos e aves: Composi&#xE7;&#xE3;o de alimentos e exig&#xEA;ncias nutricionais</source>
<edition>4.ed</edition>
<publisher-name>Departamento de Zootecnia, UFV</publisher-name>
<publisher-loc>Vi&#xE7;osa, MG</publisher-loc>
</element-citation>
<mixed-citation>Rostagno, H. S.; Albino, L. F. T.; Hannas, M. I.; Donzele, J. L.; Sakomura, N. K.; Perazzo, F. G.; Saraiva, A.; Teixeira, M. L.; Rodrigues, P. B.; Oliveira, R. F.; Barreto, S. L. T. and Brito, C. O. 2017. Tabelas Brasileiras para su&#xED;nos e aves: Composi&#xE7;&#xE3;o de alimentos e exig&#xEA;ncias nutricionais. 4.ed. Departamento de Zootecnia, UFV, Vi&#xE7;osa, MG.</mixed-citation></ref>
<ref id="B16">
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Sivandzade</surname><given-names>F.</given-names></name>
<name><surname>Prasad</surname><given-names>S.</given-names></name>
<name><surname>Bhalerao</surname><given-names>A.</given-names></name>
<name><surname>Cucullo</surname><given-names>L.</given-names></name>
</person-group>
<year>2019</year>
<article-title>NRF2 and NF-&#x3BA;B interplay in cerebrovascular and neurodegenerative disorders: molecular mechanisms and possible therapeutic approaches</article-title>
<source>Redox Biology</source>
<volume>21</volume>
<fpage>101059</fpage>
<lpage>101059</lpage>
<comment><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1016/j.redox.2018.11.017">https://doi.org/10.1016/j.redox.2018.11.017</ext-link></comment></element-citation>
<mixed-citation>Sivandzade, F.; Prasad, S.; Bhalerao, A. and Cucullo, L. 2019. NRF2 and NF-&#x3BA;B interplay in cerebrovascular and neurodegenerative disorders: molecular mechanisms and possible therapeutic approaches. Redox Biology 21:101059. https://doi.org/10.1016/j.redox.2018.11.017</mixed-citation></ref>
<ref id="B17">
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Surai</surname><given-names>P. F.</given-names></name>
<name><surname>Kochish</surname><given-names>I. I.</given-names></name>
<name><surname>Kidd</surname><given-names>M. T.</given-names></name>
</person-group>
<year>2021</year>
<article-title>Redox homeostasis in poultry: regulatory roles of NF-&#x3BA;B</article-title>
<source>Antioxidants</source>
<volume>10</volume>
<fpage>186</fpage>
<lpage>186</lpage>
<comment><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3390/antiox10020186">https://doi.org/10.3390/antiox10020186</ext-link></comment></element-citation>
<mixed-citation>Surai, P. F.; Kochish, I. I. and Kidd, M. T. 2021. Redox homeostasis in poultry: regulatory roles of NF-&#x3BA;B. Antioxidants 10:186. https://doi.org/10.3390/antiox10020186</mixed-citation></ref>
<ref id="B18">
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Thiamhirunsopit</surname><given-names>K.</given-names></name>
<name><surname>Phisalaphong</surname><given-names>C.</given-names></name>
<name><surname>Boonkird</surname><given-names>S.</given-names></name>
<name><surname>Kijparkorn</surname><given-names>S.</given-names></name>
</person-group>
<year>2014</year>
<article-title>Effect of chili meal (<italic>Capsicum frutescens</italic> LINN.) on growth performance, stress index, lipid peroxidation and ileal nutrient digestibility in broilers reared under high stocking density condition</article-title>
<source>Animal Feed Science and Technology</source>
<volume>192</volume>
<fpage>90</fpage>
<lpage>100</lpage>
<comment><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1016/j.anifeedsci.2014.03.009">https://doi.org/10.1016/j.anifeedsci.2014.03.009</ext-link></comment></element-citation>
<mixed-citation>Thiamhirunsopit, K.; Phisalaphong, C.; Boonkird, S. and Kijparkorn, S. 2014. Effect of chili meal (<italic>Capsicum frutescens</italic> LINN.) on growth performance, stress index, lipid peroxidation and ileal nutrient digestibility in broilers reared under high stocking density condition. Animal Feed Science and Technology 192:90-100. https://doi.org/10.1016/j.anifeedsci.2014.03.009</mixed-citation></ref>
<ref id="B19">
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Winiarska-Mieczan</surname><given-names>A.</given-names></name>
<name><surname>Kwiecie&#x144;</surname><given-names>M.</given-names></name>
<name><surname>Mieczan</surname><given-names>T.</given-names></name>
<name><surname>Kwiatkowska</surname><given-names>K.</given-names></name>
<name><surname>Jachimowicz</surname><given-names>K.</given-names></name>
</person-group>
<year>2021</year>
<article-title>The effect of Cu, Zn and Fe chelates on the antioxidative status of thigh meat of broiler chickens</article-title>
<source>Animal</source>
<volume>15</volume>
<fpage>100367</fpage>
<lpage>100367</lpage>
<comment><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1016/j.animal.2021.100367">https://doi.org/10.1016/j.animal.2021.100367</ext-link></comment></element-citation>
<mixed-citation>Winiarska-Mieczan, A.; Kwiecie&#x144;, M.; Mieczan, T.; Kwiatkowska, K. and Jachimowicz, K. 2021. The effect of Cu, Zn and Fe chelates on the antioxidative status of thigh meat of broiler chickens. Animal 15:100367. https://doi.org/10.1016/j.animal.2021.100367</mixed-citation></ref>
<ref id="B20">
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Xue</surname><given-names>F.</given-names></name>
<name><surname>Shi</surname><given-names>L.</given-names></name>
<name><surname>Li</surname><given-names>Y.</given-names></name>
<name><surname>Ni</surname><given-names>A.</given-names></name>
<name><surname>Ma</surname><given-names>H.</given-names></name>
<name><surname>Sun</surname><given-names>Y.</given-names></name>
<name><surname>Chen</surname><given-names>J.</given-names></name>
</person-group>
<year>2020</year>
<article-title>Effects of replacing dietary Aureomycin with a combination of plant essential oils on production performance and gastrointestinal health of broilers</article-title>
<source>Poultry Science</source>
<volume>99</volume>
<fpage>4521</fpage>
<lpage>4529</lpage>
<comment><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1016/j.psj.2020.05.030">https://doi.org/10.1016/j.psj.2020.05.030</ext-link></comment></element-citation>
<mixed-citation>Xue, F.; Shi, L.; Li, Y.; Ni, A.; Ma, H.; Sun, Y. and Chen, J. 2020. Effects of replacing dietary Aureomycin with a combination of plant essential oils on production performance and gastrointestinal health of broilers. Poultry Science 99:4521-4529. https://doi.org/10.1016/j.psj.2020.05.030</mixed-citation></ref>
</ref-list>
</back>
</article>
