<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.1 20151215//EN" "https://jats.nlm.nih.gov/publishing/1.1/JATS-journalpublishing1.dtd">
<article article-type="research-article" dtd-version="1.1" specific-use="sps-1.9" xml:lang="en" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink">
	<front>
		<journal-meta>
			<journal-id journal-id-type="publisher-id">rbz</journal-id>
			<journal-title-group>
				<journal-title>Revista Brasileira de Zootecnia</journal-title>
				<abbrev-journal-title abbrev-type="publisher">R. Bras. Zootec.</abbrev-journal-title>
			</journal-title-group>
			<issn pub-type="ppub">1516-3598</issn>
			<issn pub-type="epub">1806-9290</issn>
			<publisher>
				<publisher-name>Sociedade Brasileira de Zootecnia</publisher-name>
			</publisher>
		</journal-meta>
		<article-meta>
			<article-id pub-id-type="other">00402</article-id>
			<article-id pub-id-type="doi">10.37496/rbz5120210120</article-id>
			<article-categories>
				<subj-group subj-group-type="heading">
					<subject>Breeding and genetics</subject>
				</subj-group>
				<subj-group>
					<subject>Technical note</subject>
				</subj-group>
			</article-categories>
			<title-group>
				<article-title>Reference gene selection for quantitative PCR in liver, skeletal muscle, and jejunum of <italic>Bos indicus</italic> cattle</article-title>
			</title-group>
			<contrib-group>
				<contrib contrib-type="author">
					<contrib-id contrib-id-type="orcid">0000-0001-6067-5884</contrib-id>
					<name>
						<surname>Coelho</surname>
						<given-names>Tamara Cristina</given-names>
					</name>
					<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
				</contrib>
				<contrib contrib-type="author">
					<contrib-id contrib-id-type="orcid">0000-0002-1794-9429</contrib-id>
					<name>
						<surname>Chalfun-Junior</surname>
						<given-names>Antonio</given-names>
					</name>
					<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
				</contrib>
				<contrib contrib-type="author">
					<contrib-id contrib-id-type="orcid">0000-0001-7236-6296</contrib-id>
					<name>
						<surname>Barreto</surname>
						<given-names>Horllys Gomes</given-names>
					</name>
					<xref ref-type="aff" rid="aff3"><sup>3</sup></xref>
				</contrib>
				<contrib contrib-type="author">
					<contrib-id contrib-id-type="orcid">0000-0002-5795-6420</contrib-id>
					<name>
						<surname>Duarte</surname>
						<given-names>Marcio de Souza</given-names>
					</name>
					<xref ref-type="aff" rid="aff4"><sup>4</sup></xref>
				</contrib>
				<contrib contrib-type="author">
					<contrib-id contrib-id-type="orcid">0000-0002-2139-8199</contrib-id>
					<name>
						<surname>Garcia</surname>
						<given-names>Bruno de Oliveira</given-names>
					</name>
					<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
				</contrib>
				<contrib contrib-type="author">
					<contrib-id contrib-id-type="orcid">0000-0002-6926-2987</contrib-id>
					<name>
						<surname>Teixeira</surname>
						<given-names>Priscilla Dutra</given-names>
					</name>
					<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
				</contrib>
				<contrib contrib-type="author">
					<contrib-id contrib-id-type="orcid">0000-0003-0087-2848</contrib-id>
					<name>
						<surname>Gionbelli</surname>
						<given-names>Tathyane Ramalho Santos</given-names>
					</name>
					<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
				</contrib>
				<contrib contrib-type="author">
					<contrib-id contrib-id-type="orcid">0000-0002-1585-8486</contrib-id>
					<name>
						<surname>Ladeira</surname>
						<given-names>Márcio Machado</given-names>
					</name>
					<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
					<xref ref-type="corresp" rid="c01"><sup>*</sup></xref>
				</contrib>
			</contrib-group>
			<aff id="aff1">
				<label>1</label>
				<institution content-type="orgname">Universidade Federal de Lavras</institution>
				<institution content-type="orgdiv1">Departamento de Zootecnia</institution>
				<addr-line>
					<named-content content-type="city">Lavras</named-content>
					<named-content content-type="state">MG</named-content>
				</addr-line>
				<country country="BR">Brasil</country>
				<institution content-type="original">Universidade Federal de Lavras, Departamento de Zootecnia, Lavras, MG, Brasil.</institution>
			</aff>
			<aff id="aff2">
				<label>2</label>
				<institution content-type="orgname">Universidade Federal de Lavras</institution>
				<institution content-type="orgdiv1">Departamento de Biologia</institution>
				<institution content-type="orgdiv2">Laboratório de Fisiologia Molecular de Plantas</institution>
				<addr-line>
					<named-content content-type="city">Lavras</named-content>
					<named-content content-type="state">MG</named-content>
				</addr-line>
				<country country="BR">Brasil</country>
				<institution content-type="original">Universidade Federal de Lavras, Departamento de Biologia, Laboratório de Fisiologia Molecular de Plantas, Lavras, MG, Brasil.</institution>
			</aff>
			<aff id="aff3">
				<label>3</label>
				<institution content-type="orgname">Universidade Federal do Tocantins</institution>
				<institution content-type="orgdiv1">Departamento de Medicina</institution>
				<addr-line>
					<named-content content-type="city">Palmas</named-content>
					<named-content content-type="state">TO</named-content>
				</addr-line>
				<country country="BR">Brasil</country>
				<institution content-type="original">Universidade Federal do Tocantins, Departamento de Medicina, Palmas, TO, Brasil.</institution>
			</aff>
			<aff id="aff4">
				<label>4</label>
				<institution content-type="orgname">University of Guelph</institution>
				<institution content-type="orgdiv1">Department of Animal Biosciences</institution>
				<addr-line>
					<named-content content-type="city">Guelph</named-content>
					<named-content content-type="state">ON</named-content>
				</addr-line>
				<country country="CA">Canada</country>
				<institution content-type="original">University of Guelph, Department of Animal Biosciences, Guelph, ON, Canada.</institution>
			</aff>
			<author-notes>
				<corresp id="c01">
					<label>*</label>Corresponding author: <email>mladeira@ufla.br</email>
				</corresp>
				<fn fn-type="conflict">
					<p>Conflict of Interest</p>
					<p>The authors declare no conflict of interest.</p>
				</fn>
				<fn fn-type="con">
					<p>Author Contributions</p>
					<p>Conceptualization: A. Chalfun-Junior, H.G. Barreto, M.S. Duarte and M.M. Ladeira. Data curation: T.C. Coelho and M.M. Ladeira. Formal analysis: T.C. Coelho, H.G. Barreto, B.O. Garcia, P.D. Teixeira and T.R.S. Gionbelli. Funding acquisition: M.M. Ladeira. Investigation: A. Chalfun-Junior and B.O. Garcia. Methodology: T.C. Coelho, H.G. Barreto, B.O. Garcia, P.D. Teixeira and T.R.S. Gionbelli. Project administration: M.M. Ladeira. Supervision: A. Chalfun-Junior, P.D. Teixeira and M.M. Ladeira. Writing-original draft: T.C. Coelho, A. Chalfun-Junior, H.G. Barreto and M.S. Duarte. Writing-review &amp; editing: T.C. Coelho, A. Chalfun-Junior, M.S. Duarte, P.D. Teixeira and M.M. Ladeira.</p>
				</fn>
			</author-notes>
			<pub-date date-type="pub" publication-format="electronic">
				<day>15</day>
				<month>07</month>
				<year>2022</year>
			</pub-date>
			<pub-date date-type="collection" publication-format="electronic">
				<year>2022</year>
			</pub-date>
			<volume>51</volume>
			<elocation-id>e20210120</elocation-id>
			<history>
				<date date-type="received">
					<day>22</day>
					<month>07</month>
					<year>2021</year>
				</date>
				<date date-type="accepted">
					<day>6</day>
					<month>04</month>
					<year>2022</year>
				</date>
			</history>
			<permissions>
				<license license-type="open-access" xlink:href="https://creativecommons.org/licenses/by/4.0/" xml:lang="en">
					<license-p> This is an Open Access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. </license-p>
				</license>
			</permissions>
			<abstract>
				<title>ABSTRACT</title>
				<p>The objective of the present study was to evaluate the stability of candidate reference genes and select the genes that can be used for normalizing real-time polymerase chain reaction (PCR) in the liver, skeletal muscle, and jejunum tissues of Nellore or Nellore × Angus steers fed different diets. Fourteen purebred and 14 crossbred steers were used, in which half of the animals of each genetic group received a diet containing whole shelled corn (WSC) and the other half whole shelled corn and sugarcane bagasse (WSCB). Stability was analyzed by the RefFinder program. To validate the selection of candidate reference genes, the expression of target genes was evaluated using the different groups of reference genes. The most stable genes were <italic>18S, ACTB</italic>, and <italic>CASC3</italic> for skeletal muscle; <italic>HMBS, ACTB</italic>, and <italic>18S</italic> for the liver; and <italic>GAPDH, ACTB</italic>, and <italic>CASC3</italic> for the jejunum, regardless of breed and diet provided. Possible errors caused in data analyses were clarified comparing the more and less stable genes as reference for normalization of the target genes <italic>FASN, ACOX, SCD1, MGAM</italic>, and <italic>SLC2A1</italic>. The use of the more stable and less stable sets of reference genes may lead to different conclusions in respect to the expression profile of the target studied gene. The selection of more suitable reference genes for each experiment is of utmost importance to ensure the reliability of gene expression studies so that they can be applied in practice.</p>
			</abstract>
			<kwd-group xml:lang="en">
				<kwd>bovine</kwd>
				<kwd>housekeeping genes</kwd>
				<kwd>normalization</kwd>
				<kwd>RT-qPCR</kwd>
				<kwd>tissues</kwd>
			</kwd-group>
			<funding-group>
				<award-group>
					<funding-source>Conselho Nacional de Desenvolvimento Científico e Tecnológico</funding-source>
					<award-id>457779/2014-4</award-id>
				</award-group>
				<award-group>
					<funding-source>Fundação de Amparo à Pesquisa do Estado de Minas Gerais</funding-source>
					<award-id>CVZ–PPM: 00441-14</award-id>
				</award-group>
			</funding-group>
			<counts>
				<fig-count count="4"/>
				<table-count count="9"/>
				<equation-count count="1"/>
				<ref-count count="37"/>
			</counts>
		</article-meta>
	</front>
	<body>
		<sec sec-type="intro">
			<title>1. Introduction</title>
			<p>Elucidation of various molecular mechanisms, previously unknown, occurred after discovery of the polymerase chain reaction (PCR) method in the scientific community, which has become prominent in numerous research studies involving animal production (<xref ref-type="bibr" rid="B27">Oliveira et al., 2014</xref>; <xref ref-type="bibr" rid="B33">Teixeira et al., 2017</xref>; <xref ref-type="bibr" rid="B18">Lopes et al., 2020</xref>).</p>
			<p>The relative quantification of reverse transcription PCR (RT-qPCR) is an accurate and sensitive method to quantify mRNA levels of target genes. However, data processing can affect interpretation of results (<xref ref-type="bibr" rid="B17">Lisowski et al., 2008</xref>), being necessary a normalization to correct inevitable experimental variations. The most common method of data normalization is the reference genes, which generally have a relatively stable expression pattern in tissues, since they are required for basic cellular processes (<xref ref-type="bibr" rid="B4">Chapman and Waldenström, 2015</xref>). However, it is becoming increasingly apparent that the stability of some usual reference genes can change according to species, tissue types, and experimental conditions (<xref ref-type="bibr" rid="B17">Lisowski et al., 2008</xref>; <xref ref-type="bibr" rid="B12">Kaur et al., 2018</xref>; <xref ref-type="bibr" rid="B19">Lozano-Villegas et al., 2021</xref>).</p>
			<p>Therefore, selecting reference genes with less variation has become a requirement for RT-qPCR analysis, and an important factor for obtaining reliable results. If gene expression is normalized with a reference gene that fluctuate under experimental conditions, relevant changes in expression of the target genes can easily be missed or overemphasized (<xref ref-type="bibr" rid="B4">Chapman and Waldenström, 2015</xref>).</p>
			<p>Various studies have already described selection of reference genes associated with different experimental conditions in bovines and have selected reference genes related to the mammary gland, fat, liver (<xref ref-type="bibr" rid="B31">Saremi et al., 2012</xref>; <xref ref-type="bibr" rid="B2">Bonnet et al., 2013</xref>), skeletal muscle (<xref ref-type="bibr" rid="B20">Mberema and Sparagano, 2017</xref>), somatic cells (<xref ref-type="bibr" rid="B22">Muhaghegh-Dolatabady et al., 2017</xref>), blood (<xref ref-type="bibr" rid="B19">Lozano-Villegas et al., 2021</xref>), and kidney, pituitary gland, and thyroid (<xref ref-type="bibr" rid="B17">Lisowski et al., 2008</xref>). However, there are no studies regarding the reference genes more suitable to muscle, liver, and jejunum in Zebu cattle under nutritional stress.</p>
			<p>The hypothesis of this study is that the stability of reference genes differs among genetic groups and diets, and that this may result in errors in analysis of gene expression. Thus, this study aimed to evaluate the stability of candidate reference genes and select the genes that can be used for normalizing RT-PCR in the liver, skeletal muscle, and jejunum tissues of Nellore or Nellore × Angus steers fed different diets.</p>
		</sec>
		<sec sec-type="materials|methods">
			<title>2. Material and Methods</title>
			<sec>
				<title>2.1. Animals, diets, and sample collection</title>
				<p>Research on animals was conducted according to ethical standards and approved by the local Ethics and Animal Welfare Committee (protocol 056/15).</p>
				<p>Fourteen Nellore purebred steers and 14 Angus × Nellore crossbred steers with mean age of 25 months and body weight of 353±25.3 kg were housed in individual pens into a completely randomized design in a 2 × 2 factorial arrangement (two diets and two breeds). Half of the animals of each genetic group received a diet containing whole shelled corn (WSC) and the other half received whole shelled corn and sugarcane bagasse (WSCB) (<xref ref-type="table" rid="t1">Table 1</xref>).</p>
				<p>
					<table-wrap id="t1">
						<label>Table 1</label>
						<caption>
							<title>Percentage of ingredients and chemical composition of experimental diets</title>
						</caption>
						<table frame="hsides" rules="groups">
							<colgroup>
								<col/>
								<col/>
								<col/>
							</colgroup>
							<thead>
								<tr>
									<th align="left" rowspan="2" style="font-weight:normal">Ingredient</th>
									<th colspan="2" style="font-weight:normal">Composition (%DM)</th>
								</tr>
								<tr>
									<th style="font-weight:normal">WSC</th>
									<th style="font-weight:normal">WSCB</th>
								</tr>
							</thead>
							<tbody>
								<tr>
									<td>Whole shelled corn</td>
									<td align="center">80.0</td>
									<td align="center">74.0</td>
								</tr>
								<tr>
									<td>Sugarcane bagasse</td>
									<td align="center">-</td>
									<td align="center">6.0</td>
								</tr>
								<tr>
									<td>Min. premix protein<sup>1</sup></td>
									<td align="center">20.0</td>
									<td align="center">20.0</td>
								</tr>
								<tr>
									<td>Nutrient, DM</td>
									<td> </td>
									<td> </td>
								</tr>
								<tr>
									<td>Dry matter (as-fed basis)</td>
									<td align="center">89.0</td>
									<td align="center">88.0</td>
								</tr>
								<tr>
									<td>Crude protein</td>
									<td align="center">15.0</td>
									<td align="center">14.7</td>
								</tr>
								<tr>
									<td>Neutral detergent fiber</td>
									<td align="center">15.2</td>
									<td align="center">19.0</td>
								</tr>
								<tr>
									<td>Non-fiber carbohydrates</td>
									<td align="center">60.0</td>
									<td align="center">56.7</td>
								</tr>
								<tr>
									<td>Starch</td>
									<td align="center">57.2</td>
									<td align="center">52.9</td>
								</tr>
								<tr>
									<td>Ether extract</td>
									<td align="center">3.17</td>
									<td align="center">3.03</td>
								</tr>
								<tr>
									<td>Metabolizable energy (Mcal/kg DM)</td>
									<td align="center">3.00</td>
									<td align="center">2.65</td>
								</tr>
							</tbody>
						</table>
						<table-wrap-foot>
							<fn id="TFN1">
								<p>WSC - whole shelled corn; WSCB - whole shelled corn and sugarcane bagasse.</p>
							</fn>
							<fn id="TFN2">
								<p>1 Guaranteed analysis per kilogram of product: CP, 32.0%; NDF, 21.6%; Ca, 45 g/kg; Mg, 7.5 g/kg; P, 11 g/kg; Cu, 104 mg/kg; Zn, 344 mg/kg; Se, 0.83 mg/kg; virginiamycin, 140 mg/kg; vitamin A, 30,500 IU/kg; vitamin D, 3800 IU/kg; vitamin E, 134 IU/kg.</p>
							</fn>
						</table-wrap-foot>
					</table-wrap>
				</p>
				<p>The animals were slaughtered after the experimental period of 96 days preceded by a 20-day adaptation period. Muscle, liver, and jejunum samples were collected soon after slaughter, labeled, and placed in 5-mL cryogenic tubes, frozen, and transported in liquid nitrogen until being stored in an ultra-freezer (−80 °C).</p>
			</sec>
			<sec>
				<title>2.2. Design and efficiency of the primers</title>
				<p>The primers of the reference genes were designed by means of sequences registered and published in the GenBank public database, at the National Center for Biotechnology Information (NCBI) platform. Characterization of the genes and the Open Reading Frames (ORF) of the selected sequences were obtained by the ORFinder tool of the NCBI. The primers were designed using the Oligo Perfect Designer software based on the sequence accessed in the GenBank and analyzed using OligoAnalizer 3.1.</p>
				<p>Primers were then commercially synthesized (Invitrogen, Carlsbad, CA, USA), and the coefficient of regression (R<sup>2</sup>) and its efficiencies (E%) (<xref ref-type="table" rid="t2">Table 2</xref>) were determined from a pool of samples diluted at ratios of 1:5, 1:25, 1:125, 1:625, and 1:3125.</p>
				<p>
					<table-wrap id="t2">
						<label>Table 2</label>
						<caption>
							<title>Description of the candidate reference genes and of the target genes for bovines</title>
						</caption>
						<table frame="hsides" rules="groups">
							<colgroup>
								<col/>
								<col/>
								<col/>
								<col/>
								<col/>
								<col/>
								<col/>
							</colgroup>
							<thead>
								<tr>
									<th align="left" style="font-weight:normal">Gene</th>
									<th style="font-weight:normal">Accession number</th>
									<th style="font-weight:normal">Primer sequence</th>
									<th style="font-weight:normal">Base pairs (bp)</th>
									<th style="font-weight:normal">Slope</th>
									<th style="font-weight:normal">Efficiency (E%)</th>
									<th style="font-weight:normal">R<sup>2</sup></th>
								</tr>
							</thead>
							<tbody>
								<tr>
									<td><italic>ACTB</italic></td>
									<td align="center">NM_173979.3</td>
									<td>F GTCCACCTTCCAGCAGATGT</td>
									<td align="center">90</td>
									<td align="center">−3.213</td>
									<td align="center">105</td>
									<td align="center">0.998</td>
								</tr>
								<tr>
									<td> </td>
									<td> </td>
									<td>R CAGTCCGCCTAGAAGCATTT</td>
									<td> </td>
									<td> </td>
									<td> </td>
									<td> </td>
								</tr>
								<tr>
									<td><italic>CASC3</italic></td>
									<td align="center">NM_001098069.1</td>
									<td>F GGACCTCCACCTCAGTTCAA</td>
									<td align="center">85</td>
									<td align="center">−3.378</td>
									<td align="center">98</td>
									<td align="center">0.976</td>
								</tr>
								<tr>
									<td> </td>
									<td> </td>
									<td>R GTCTTTGCCGTTGTGATGAA</td>
									<td> </td>
									<td> </td>
									<td> </td>
									<td> </td>
								</tr>
								<tr>
									<td><italic>EEF1A2</italic></td>
									<td align="center">NM_001037464.2</td>
									<td>F GTCATTGACTGCCACACAGC</td>
									<td align="center">87</td>
									<td align="center">−3.494</td>
									<td align="center">93</td>
									<td align="center">0.997</td>
								</tr>
								<tr>
									<td> </td>
									<td> </td>
									<td>R CTCCAACTTCTTGCCAGAGC</td>
									<td> </td>
									<td> </td>
									<td> </td>
									<td> </td>
								</tr>
								<tr>
									<td><italic>GAPDH</italic></td>
									<td align="center">NM_001034034.2</td>
									<td>F CATTGCCCTCAACGACCACTT</td>
									<td align="center">78</td>
									<td align="center">−3.370</td>
									<td align="center">98</td>
									<td align="center">0.995</td>
								</tr>
								<tr>
									<td> </td>
									<td> </td>
									<td>R TCCACCACCCTGTTGCTGTA</td>
									<td> </td>
									<td> </td>
									<td> </td>
									<td> </td>
								</tr>
								<tr>
									<td><italic>HMBS</italic></td>
									<td align="center">NM_001046207.1</td>
									<td>F GGAAGAAGACACCCCAAAGA</td>
									<td align="center">80</td>
									<td align="center">−3.305</td>
									<td align="center">101</td>
									<td align="center">0.996</td>
								</tr>
								<tr>
									<td> </td>
									<td> </td>
									<td>R CACTGTCCGTCTGTATGCGA</td>
									<td> </td>
									<td> </td>
									<td> </td>
									<td> </td>
								</tr>
								<tr>
									<td><italic>UBC</italic></td>
									<td align="center">NM_001206307.1</td>
									<td>F CGCACCCTGTCTGACTACAA</td>
									<td align="center">82</td>
									<td align="center">−3.145</td>
									<td align="center">108</td>
									<td align="center">0.99</td>
								</tr>
								<tr>
									<td> </td>
									<td> </td>
									<td>R GAGAACTTAAAACACCTCCCC</td>
									<td> </td>
									<td> </td>
									<td> </td>
									<td> </td>
								</tr>
								<tr>
									<td><italic>18S</italic></td>
									<td align="center">NR_036642.1</td>
									<td>F CCAGTAAGTGCGGGTCATAA</td>
									<td align="center">84</td>
									<td align="center">−3.346</td>
									<td align="center">99</td>
									<td align="center">0.999</td>
								</tr>
								<tr>
									<td> </td>
									<td> </td>
									<td>R CCATCCAATCGGTAGTAGCG</td>
									<td> </td>
									<td> </td>
									<td> </td>
									<td> </td>
								</tr>
								<tr>
									<td><italic>MGAM</italic></td>
									<td align="center">XM_010804619.2</td>
									<td>F TGTGACCACCTCCATTTCAA</td>
									<td align="center">86</td>
									<td align="center">−3.602</td>
									<td align="center">90</td>
									<td align="center">0.997</td>
								</tr>
								<tr>
									<td> </td>
									<td> </td>
									<td>R GTCCCAGTACCAGTCCCTCA</td>
									<td> </td>
									<td> </td>
									<td> </td>
									<td> </td>
								</tr>
								<tr>
									<td><italic>SLC2A1</italic></td>
									<td align="center">AF508807.1</td>
									<td>F ATGGACAGTAGCACCTGGAG</td>
									<td align="center">115</td>
									<td align="center">−3.349</td>
									<td align="center">99</td>
									<td align="center">0.986</td>
								</tr>
								<tr>
									<td> </td>
									<td> </td>
									<td>R CCACCACGAAGTAGATGACG</td>
									<td> </td>
									<td> </td>
									<td> </td>
									<td> </td>
								</tr>
								<tr>
									<td><italic>SCD1</italic></td>
									<td align="center">NM_173959.4</td>
									<td>F ACCATCACAGCACCTCCTTC</td>
									<td align="center">95</td>
									<td align="center">−3.383</td>
									<td align="center">98</td>
									<td align="center">0.999</td>
								</tr>
								<tr>
									<td> </td>
									<td> </td>
									<td>R ATTTCAGGGCGGATGTCTTC</td>
									<td> </td>
									<td> </td>
									<td> </td>
									<td> </td>
								</tr>
								<tr>
									<td><italic>FASN</italic></td>
									<td align="center">U34794.1</td>
									<td>F ATCAACTCTGAGGGGCTGAA</td>
									<td align="center">83</td>
									<td align="center">−3.334</td>
									<td align="center">99.5</td>
									<td align="center">0.974</td>
								</tr>
								<tr>
									<td> </td>
									<td> </td>
									<td>R CAACAAAACTGGTGCTCACG</td>
									<td> </td>
									<td> </td>
									<td> </td>
									<td> </td>
								</tr>
								<tr>
									<td><italic>ACOX</italic></td>
									<td align="center">BC102761.2</td>
									<td>F GCTGTCCTAAGGCGTTTGTG</td>
									<td align="center">83</td>
									<td align="center">−3.346</td>
									<td align="center">99</td>
									<td align="center">0.994</td>
								</tr>
								<tr>
									<td> </td>
									<td> </td>
									<td>R ATGATGCTCCCCTGAAGAAA</td>
									<td> </td>
									<td> </td>
									<td> </td>
									<td> </td>
								</tr>
							</tbody>
						</table>
						<table-wrap-foot>
							<fn id="TFN3">
								<p>R<sup>2</sup> - coefficient of regression.</p>
							</fn>
							<fn id="TFN4">
								<p>a: muscle of purebred and crossbred steers; b: liver of purebred and crossbred steers; c: jejunum of purebred and crossbred steers.</p>
							</fn>
							<fn id="TFN5">
								<p>N - Nellore; NA - Nellore × Angus.</p>
							</fn>
						</table-wrap-foot>
					</table-wrap>
				</p>
			</sec>
			<sec>
				<title>2.3. RNA extraction and cDNA synthesis</title>
				<p>RNA extraction was performed using two methods, in accordance with the tissue studied to avoid degradation and also to get better quality and quantity. RNA was extracted from muscle samples (80-100 mg) using the reagent Trizol (Invitrogen, Gaithersburg, MD, USA) according to manufacturer’s instructions and was homogenized (IKA<sup>®</sup> T18 ULTRA-TURRAX<sup>®</sup> Basic Homogenizer, Wilmington, NC, USA) together with 1 mL of Trizol reagent. Adaptations were made in relation to the amounts of chloroform (300 µL) and isopropanol (400 µL), and the step of chloroform addition was performed twice. Samples were treated with DNase DNA free (Ambion, Austin, TX, USA) to eliminate possible contaminations.</p>
				<p>The liver and jejunum RNA were extracted using the Promega SV RNA Isolation kit (Promega, Madison, WI, USA) according to manufacturers. Tissue samples were weighed (130 mg) and homogenized (IKA<sup>®</sup> T18 ULTRA-TURRAX<sup>®</sup> Basic Homogenizer, Wilmington, NC, USA with 1 mL of RNA Lysis Buffer (RLA).</p>
				<p>Samples were then quantified in a nanospectrophotometer (DeNovix DS-11, Wilmington, DE, USA) at A260 nm for the purpose of determining the amount (ng/μL) and purity (260/280 and 260/230) of the extracted RNA. After these procedures, the RNA samples were stored at −80 ℃.</p>
				<p>Two methods were used for cDNA synthesis: the High-Capacity cDNA Reverse Transcription kit (Applied Biosystems, Foster City, CA, USA) for muscle samples, and the GoScript™ reverse transcription kit (Promega, Madison, WI, USA) for liver and jejunum samples, according to manufacturers’ specifications.</p>
			</sec>
			<sec>
				<title>2.4. Quantitative gene expression analysis</title>
				<p>For quantitative gene expression analysis by RT-qPCR, the Mastercycler<sup>®</sup> ep Realplex (Eppendorf) model was used with the SYBR Green detection system (Applied Biosystems, Foster City, CA, USA) and the cDNA obtained from RNA extracted from the liver, muscle, and jejunum of bovines. The thermal reaction conditions were 2 min at 50 ℃ and 10 min at 95 ℃, followed by 40 cycles of 15 s at 95 ℃ and 1 min at 60 ℃, ending with the melting curve. For each reaction, 1 μL of cDNA at the concentration of 1:5, 0.3 μL of each primer (1.2 µM), and 5.0 μL of Master Mix SYBR Green were used, for a final volume of 10.0 μL/sample on a MicroAmp Optical 96-well reaction plate (Applied Biosystems, Foster City, CA, USA).</p>
				<p>The entire RT-qPCR experiment for each gene under study was conducted from cDNAs obtained from seven biological replications, with three technical replicates for each one. The Cq was determined by the number of cycles in which the fluorescence generated within a reaction crosses the baseline (threshold).</p>
			</sec>
			<sec>
				<title>2.5. Data and statistical analysis</title>
				<sec>
					<title>2.5.1. Evaluation of reference genes</title>
					<p>The data were calibrated by the GenEX program (MultiD, Gothenburg, Sweden) for correcting the values according to the efficiency found for each gene evaluated. The SigmaPlot 12.0 software was employed for construction of boxplot diagrams to illustrate the levels and variations in expression of candidate reference genes. Data were then analyzed using the RefFinder online program, and thus the more stable genes for each condition were determined. Pairwise evaluation was carried out by the GeNorm algorithm to determine the minimum number of genes necessary; we needed to add one gene as a reference when the standard deviation (SD) was greater than 0.15.</p>
				</sec>
				<sec>
					<title>2.5.2. Validation of expression of reference genes</title>
					<p>For validation of the reference genes, a completely randomized design in a 2 × 2 factorial arrangement was used, with four treatments [Nellore steers fed a whole shelled corn diet (NWSC); Nellore steers fed a whole shelled corn and sugarcane bagasse diet (NWSCB); Nellore × Angus steers fed a whole shelled corn diet (NAWSC); and Nellore × Angus steers fed a whole shelled corn and sugarcane bagasse diet (NAWSCB)] and seven replications per treatment. Relative expression of target genes were calculated according to the method described by <xref ref-type="bibr" rid="B29">Pfaffl (2001)</xref>, which is based on Cq values that are corrected for the amplification efficiency of each primer pair.</p>
					<p>Gene expressions were analyzed using the PROC MIXED procedure of SAS (Statistical Analysis System, version 9.2), through the model:</p>
					<disp-formula id="e1">
						<mml:math>
							<mml:msub>
								<mml:mi>γ</mml:mi>
								<mml:mrow>
									<mml:mi>i</mml:mi>
									<mml:mi>j</mml:mi>
								</mml:mrow>
							</mml:msub>
							<mml:mo> </mml:mo>
							<mml:mo>=</mml:mo>
							<mml:mo> </mml:mo>
							<mml:mi>μ</mml:mi>
							<mml:mo> </mml:mo>
							<mml:mo>+</mml:mo>
							<mml:mo> </mml:mo>
							<mml:msub>
								<mml:mi>α</mml:mi>
								<mml:mi>i</mml:mi>
							</mml:msub>
							<mml:mo> </mml:mo>
							<mml:mo>+</mml:mo>
							<mml:mo> </mml:mo>
							<mml:msub>
								<mml:mi>β</mml:mi>
								<mml:mi>j</mml:mi>
							</mml:msub>
							<mml:mo> </mml:mo>
							<mml:mo>+</mml:mo>
							<mml:mo> </mml:mo>
							<mml:msub>
								<mml:mfenced>
									<mml:mrow>
										<mml:mi>α</mml:mi>
										<mml:mi>β</mml:mi>
									</mml:mrow>
								</mml:mfenced>
								<mml:mrow>
									<mml:mi>i</mml:mi>
									<mml:mi>j</mml:mi>
								</mml:mrow>
							</mml:msub>
							<mml:mo> </mml:mo>
							<mml:mo>+</mml:mo>
							<mml:mo> </mml:mo>
							<mml:msub>
								<mml:mi>e</mml:mi>
								<mml:mrow>
									<mml:mi>i</mml:mi>
									<mml:mi>j</mml:mi>
								</mml:mrow>
							</mml:msub>
						</mml:math>
						<label>(1)</label>
					</disp-formula>
					<p>in which γ<sub><italic>ij</italic></sub> is the response variable measured, <italic>μ</italic> is the overall mean, <italic>α</italic><sub><italic>i</italic></sub> is the <italic>i</italic>-th level of the fixed effect of diet (two levels), <italic>β</italic><sub><italic>j</italic></sub> is the <italic>j</italic>-th level of the fixed effect of breed (two levels), <italic>αβ</italic><sub><italic>ij</italic></sub> is the interaction of breed (<italic>β</italic><sub><italic>j</italic></sub>) and diet (<italic>α</italic><sub><italic>i</italic></sub>), and <italic>e</italic><sub><italic>ij</italic></sub> is the random error associated with γ<sub><italic>ij</italic></sub>.</p>
					<p>A Shapiro-Wilk test was used to analyze data normality, when gene expression data did not exhibit normal distribution, the data were transformed using the RANK procedure of SAS. After that, analysis of variance (ANOVA) and Tukey’s test were used on the validation data of reference genes to determine statistical differences among the means of the different treatments.</p>
				</sec>
			</sec>
		</sec>
		<sec sec-type="results">
			<title>3. Results</title>
			<p>Levels of gene expression were determined from values of the Quantification cycle (Cq) of the seven reference genes evaluated in the different tissues of the animals, regardless of their genetic group and diets. Simultaneous evaluation of the effect of breeds and diets on muscle, liver, and jejunum tissue (<xref ref-type="fig" rid="f01">Figure 1</xref>) showed that the lowest mean Cq values were 11.9, 11.9, and 13.7 and the highest were 25.7, 27, and 27.4, respectively.</p>
			<p>
				<fig id="f01">
					<label>Figure 1</label>
					<caption>
						<title>Variation in the expression of candidate reference genes in the breeds in different tissues.</title>
					</caption>
					<graphic xlink:href="1806-9290-rbz-51-e20210120-gf01.tif"/>
				</fig>
			</p>
			<p>The ranking of candidate reference genes was obtained by the RefFinder program from the geometric mean of the results from the software programs GeNorm, BestKeeper, NormFinder, and Delta Cq. The minimum number of genes for tissues, breeds, and the combination between variables were determined by pairwise analysis by the GeNorm algorithm (<xref ref-type="bibr" rid="B35">Vandesompele et al., 2002</xref>). <xref ref-type="bibr" rid="B35">Vandesompele et al. (2002)</xref> proposed 0.15 as the cutoff value for the paired variation. After inclusion of the second reference gene, a substantial reduction in the V value (0.15) was observed in GeNorm, showing the need for at least two and at most four reference genes for normalization of the study for the different conditions of this study (<xref ref-type="table" rid="t3">Tables 3-5</xref>). For the muscle of pure and crossbred animals fed WSC four reference genes were needed (<xref ref-type="table" rid="t3">Table 3</xref>); on the other hand, for liver (<xref ref-type="table" rid="t4">Table 4</xref>) and jejunum (<xref ref-type="table" rid="t5">Table 5</xref>), the minimum number of genes was three.</p>
			<p>
				<table-wrap id="t3">
					<label>Table 3</label>
					<caption>
						<title>Reference genes and minimum number of genes recommended for normalization in real time PCR studies in pure- (Nellore) and crossbred (Nellore × Angus) animals in skeletal muscle</title>
					</caption>
					<table frame="hsides" rules="groups">
						<colgroup>
							<col/>
							<col/>
							<col/>
							<col/>
							<col/>
							<col/>
							<col/>
							<col/>
							<col/>
						</colgroup>
						<thead>
							<tr>
								<th align="left" rowspan="2" style="font-weight:normal">Breed</th>
								<th rowspan="2" style="font-weight:normal">Diet</th>
								<th colspan="7" style="font-weight:normal">Reference gene<sup>1</sup></th>
							</tr>
							<tr>
								<th style="font-weight:normal"><italic>18S</italic></th>
								<th style="font-weight:normal"><italic>ACTB</italic></th>
								<th style="font-weight:normal"><italic>CASC3</italic></th>
								<th style="font-weight:normal"><italic>EEF1A2</italic></th>
								<th style="font-weight:normal"><italic>GAPDH</italic></th>
								<th style="font-weight:normal"><italic>HMBS</italic></th>
								<th style="font-weight:normal"><italic>UBC</italic></th>
							</tr>
						</thead>
						<tbody>
							<tr>
								<td>Pure- and crossbred</td>
								<td align="center">WSC/WSCB</td>
								<td align="center">x</td>
								<td align="center">x</td>
								<td align="center">x</td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
							</tr>
							<tr>
								<td>Pure- and crossbred</td>
								<td align="center">WSC</td>
								<td align="center">x</td>
								<td align="center">x</td>
								<td align="center">x</td>
								<td align="center">x</td>
								<td> </td>
								<td> </td>
								<td> </td>
							</tr>
							<tr>
								<td>Pure- and crossbred</td>
								<td align="center">WSCB</td>
								<td align="center">x</td>
								<td align="center">x</td>
								<td align="center">x</td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
							</tr>
							<tr>
								<td>Purebred</td>
								<td align="center">WSC/WSCB</td>
								<td align="center">x</td>
								<td align="center">x</td>
								<td> </td>
								<td align="center">x</td>
								<td> </td>
								<td> </td>
								<td> </td>
							</tr>
							<tr>
								<td>Purebred</td>
								<td align="center">WSC</td>
								<td align="center">x</td>
								<td align="center">x</td>
								<td> </td>
								<td align="center">x</td>
								<td> </td>
								<td> </td>
								<td> </td>
							</tr>
							<tr>
								<td>Purebred</td>
								<td align="center">WSCB</td>
								<td> </td>
								<td align="center">x</td>
								<td> </td>
								<td align="center">x</td>
								<td> </td>
								<td> </td>
								<td> </td>
							</tr>
							<tr>
								<td>Crossbred</td>
								<td align="center">WSC/WSCB</td>
								<td align="center">x</td>
								<td align="center">x</td>
								<td align="center">x</td>
								<td align="center">x</td>
								<td> </td>
								<td> </td>
								<td> </td>
							</tr>
							<tr>
								<td>Crossbred</td>
								<td align="center">WSC</td>
								<td align="center">x</td>
								<td align="center">x</td>
								<td align="center">x</td>
								<td align="center">x</td>
								<td> </td>
								<td> </td>
								<td> </td>
							</tr>
							<tr>
								<td>Crossbred</td>
								<td align="center">WSCB</td>
								<td align="center">x</td>
								<td align="center">x</td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
							</tr>
						</tbody>
					</table>
					<table-wrap-foot>
						<fn id="TFN6">
							<p>PCR - polymerase chain reaction; WSC - whole shelled corn; WSCB - whole shelled corn and sugarcane bagasse.</p>
						</fn>
						<fn id="TFN7">
							<p><sup>1</sup> Recommended reference gene was obtained by the RefFinder program, and the number of genes was determined by the GeNorm algorithm.</p>
						</fn>
					</table-wrap-foot>
				</table-wrap>
			</p>
			<p>
				<table-wrap id="t4">
					<label>Table 4</label>
					<caption>
						<title>Reference genes and minimum number of genes recommended for normalization in real time PCR studies in pure- (Nellore) and crossbred (Nellore × Angus) animals in the liver</title>
					</caption>
					<table frame="hsides" rules="groups">
						<colgroup>
							<col/>
							<col/>
							<col/>
							<col/>
							<col/>
							<col/>
							<col/>
							<col/>
							<col/>
						</colgroup>
						<thead>
							<tr>
								<th align="left" rowspan="2" style="font-weight:normal">Breed</th>
								<th rowspan="2" style="font-weight:normal">Diet</th>
								<th colspan="7" style="font-weight:normal">Reference gene<sup>1</sup></th>
							</tr>
							<tr>
								<th style="font-weight:normal"><italic>18S</italic></th>
								<th style="font-weight:normal"><italic>ACTB</italic></th>
								<th style="font-weight:normal"><italic>CASC3</italic></th>
								<th style="font-weight:normal"><italic>EEF1A2</italic></th>
								<th style="font-weight:normal"><italic>GAPDH</italic></th>
								<th style="font-weight:normal"><italic>HMBS</italic></th>
								<th style="font-weight:normal"><italic>UBC</italic></th>
							</tr>
						</thead>
						<tbody>
							<tr>
								<td>Pure- and crossbred</td>
								<td align="center">WSC/WSCB</td>
								<td align="center">x</td>
								<td align="center">x</td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td align="center">x</td>
								<td> </td>
							</tr>
							<tr>
								<td>Pure- and crossbred</td>
								<td align="center">WSC</td>
								<td align="center">x</td>
								<td align="center">x</td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td align="center">x</td>
								<td> </td>
							</tr>
							<tr>
								<td>Pure- and crossbred</td>
								<td align="center">WSCB</td>
								<td align="center">x</td>
								<td align="center">x</td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td align="center">x</td>
								<td> </td>
							</tr>
							<tr>
								<td>Purebred</td>
								<td align="center">WSC/WSCB</td>
								<td align="center">x</td>
								<td align="center">x</td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td align="center">x</td>
								<td> </td>
							</tr>
							<tr>
								<td>Purebred</td>
								<td align="center">WSC</td>
								<td align="center">x</td>
								<td align="center">x</td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td align="center">x</td>
								<td> </td>
							</tr>
							<tr>
								<td>Purebred</td>
								<td align="center">WSCB</td>
								<td align="center">x</td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td align="center">x</td>
							</tr>
							<tr>
								<td>Crossbred</td>
								<td align="center">WSC/WSCB</td>
								<td> </td>
								<td align="center">x</td>
								<td> </td>
								<td> </td>
								<td align="center">x</td>
								<td> </td>
								<td> </td>
							</tr>
							<tr>
								<td>Crossbred</td>
								<td align="center">WSC</td>
								<td> </td>
								<td align="center">x</td>
								<td> </td>
								<td> </td>
								<td align="center">x</td>
								<td align="center">x</td>
								<td> </td>
							</tr>
							<tr>
								<td>Crossbred</td>
								<td align="center">WSCB</td>
								<td align="center">x</td>
								<td align="center">x</td>
								<td> </td>
								<td> </td>
								<td> </td>
								<td align="center">x</td>
								<td> </td>
							</tr>
						</tbody>
					</table>
					<table-wrap-foot>
						<fn id="TFN8">
							<p>PCR - polymerase chain reaction; WSC - whole shelled corn; WSCB - whole shelled corn and sugarcane bagasse.</p>
						</fn>
						<fn id="TFN9">
							<p><sup>1</sup> Recommended reference gene was obtained by the RefFinder program, and the number of genes was determined by the GeNorm algorithm.</p>
						</fn>
					</table-wrap-foot>
				</table-wrap>
			</p>
			<p>
				<table-wrap id="t5">
					<label>Table 5</label>
					<caption>
						<title>Reference genes and minimum number of genes recommended for normalization in real time PCR studies in pure- (Nellore) and crossbred (Nellore × Angus) animals in the jejunum</title>
					</caption>
					<table frame="hsides" rules="groups">
						<colgroup>
							<col/>
							<col/>
							<col/>
							<col/>
							<col/>
							<col/>
							<col/>
							<col/>
							<col/>
						</colgroup>
						<thead>
							<tr>
								<th align="left" rowspan="2" style="font-weight:normal">Breed</th>
								<th rowspan="2" style="font-weight:normal">Diet</th>
								<th colspan="7" style="font-weight:normal">Reference gene<sup>1</sup></th>
							</tr>
							<tr>
								<th style="font-weight:normal"><italic>18S</italic></th>
								<th style="font-weight:normal"><italic>ACTB</italic></th>
								<th style="font-weight:normal"><italic>CASC3</italic></th>
								<th style="font-weight:normal"><italic>EEF1A2</italic></th>
								<th style="font-weight:normal"><italic>GAPDH</italic></th>
								<th style="font-weight:normal"><italic>HMBS</italic></th>
								<th style="font-weight:normal"><italic>UBC</italic></th>
							</tr>
						</thead>
						<tbody>
							<tr>
								<td>Pure- and crossbred</td>
								<td align="center">WSC/WSCB</td>
								<td> </td>
								<td align="center">x</td>
								<td align="center">x</td>
								<td> </td>
								<td align="center">x</td>
								<td> </td>
								<td> </td>
							</tr>
							<tr>
								<td>Pure- and crossbred</td>
								<td align="center">WSC</td>
								<td> </td>
								<td align="center">x</td>
								<td align="center">x</td>
								<td> </td>
								<td align="center">x</td>
								<td> </td>
								<td> </td>
							</tr>
							<tr>
								<td>Pure- and crossbred</td>
								<td align="center">WSCB</td>
								<td> </td>
								<td align="center">x</td>
								<td> </td>
								<td> </td>
								<td align="center">x</td>
								<td> </td>
								<td> </td>
							</tr>
							<tr>
								<td>Purebred</td>
								<td align="center">WSC/WSCB</td>
								<td align="center">x</td>
								<td align="center">x</td>
								<td> </td>
								<td> </td>
								<td align="center">x</td>
								<td> </td>
								<td> </td>
							</tr>
							<tr>
								<td>Purebred</td>
								<td align="center">WSC</td>
								<td> </td>
								<td align="center">x</td>
								<td> </td>
								<td> </td>
								<td align="center">x</td>
								<td> </td>
								<td> </td>
							</tr>
							<tr>
								<td>Purebred</td>
								<td align="center">WSCB</td>
								<td> </td>
								<td align="center">x</td>
								<td> </td>
								<td> </td>
								<td align="center">x</td>
								<td> </td>
								<td> </td>
							</tr>
							<tr>
								<td>Crossbred</td>
								<td align="center">WSC/WSCB</td>
								<td> </td>
								<td align="center">x</td>
								<td align="center">x</td>
								<td> </td>
								<td align="center">x</td>
								<td> </td>
								<td> </td>
							</tr>
							<tr>
								<td>Crossbred</td>
								<td align="center">WSC</td>
								<td> </td>
								<td align="center">x</td>
								<td align="center">x</td>
								<td> </td>
								<td align="center">x</td>
								<td> </td>
								<td> </td>
							</tr>
							<tr>
								<td>Crossbred</td>
								<td align="center">WSCB</td>
								<td> </td>
								<td align="center">x</td>
								<td align="center">x</td>
								<td> </td>
								<td align="center">x</td>
								<td> </td>
								<td> </td>
							</tr>
						</tbody>
					</table>
					<table-wrap-foot>
						<fn id="TFN10">
							<p>PCR - polymerase chain reaction; WSC - whole shelled corn; WSCB - whole shelled corn and sugarcane bagasse.</p>
						</fn>
						<fn id="TFN11">
							<p><sup>1</sup> Recommended reference gene was obtained by the RefFinder program, and the number of genes was determined by the GeNorm algorithm.</p>
						</fn>
					</table-wrap-foot>
				</table-wrap>
			</p>
			<p>The results obtained showed that the ranking (more stable to the less stable gene) for the muscle according to the RefFinder program were <italic>Ribosomal Protein 18S</italic> (<italic>18S</italic>), <italic>Beta-actin</italic> (<italic>ACTB</italic>), <italic>Cancer susceptibility candidate 3</italic> (<italic>CASC3</italic>), <italic>Eukaryotic translation elongation factor 1 alpha 2</italic> (<italic>EEF1A2</italic>)<italic>, Glyceraldehyde-3-phosphate</italic> (<italic>GAPDH</italic>)<italic>, Hydroxymethylbilane synthase mRNA</italic> (<italic>HMBS</italic>), and <italic>Ubiquitin C</italic> (<italic>UBC</italic>) (<xref ref-type="table" rid="t6">Table 6</xref>), being <italic>18S, ACTB, CASC3</italic>, and <italic>EEF1A2</italic> (<xref ref-type="table" rid="t3">Table 3</xref>) the most stable genes. The use of <italic>CASC3</italic> in purebred animals and of <italic>EEF1A2</italic> was expendable in comparing the different genetic groups and diets simultaneously (<xref ref-type="table" rid="t3">Table 3</xref>). For the liver, the ranking of the reference genes (RefFinder method) was <italic>HMBS, ACTB, 18S, CASC3, GAPDH, UBC</italic>, and <italic>EEF1A2</italic> (<xref ref-type="table" rid="t7">Table 7</xref>) and the most stable genes were <italic>HMBS, ACTB, 18S</italic>, and <italic>GAPDH</italic> (<xref ref-type="table" rid="t4">Table 4</xref>). In the crossbred animals receiving the two diets or only WSC, <italic>GAPDH</italic> was more stable than the <italic>18S</italic> gene that was selected in purebred animals. Finally, in the jejunum, the most stable reference genes were <italic>GAPDH, ACTB, CASC3</italic>, and <italic>18S</italic> (<xref ref-type="table" rid="t5">Table 5</xref>), considering that the ranking of the reference genes were <italic>GAPDH, ACTB, CASC3, UBC, HMBS, 18S</italic>, and <italic>EEF1A2</italic> (<xref ref-type="table" rid="t8">Table 8</xref>). In general, there was a small effect of diet on the reference genes in the tissues.</p>
			<p>
				<table-wrap id="t6">
					<label>Table 6</label>
					<caption>
						<title>Ranking of reference genes in the muscle of pure- and crossbred animals, regardless of the diet, by the different evaluation methods</title>
					</caption>
					<table frame="hsides" rules="groups">
						<colgroup>
							<col/>
							<col/>
							<col/>
							<col/>
							<col/>
							<col/>
							<col/>
							<col/>
						</colgroup>
						<thead>
							<tr>
								<th align="left" rowspan="2" style="font-weight:normal">Method</th>
								<th colspan="7" style="font-weight:normal">&lt;------- More stable Less stable -------&gt;</th>
							</tr>
							<tr>
								<th style="font-weight:normal">1</th>
								<th style="font-weight:normal">2</th>
								<th style="font-weight:normal">3</th>
								<th style="font-weight:normal">4</th>
								<th style="font-weight:normal">5</th>
								<th style="font-weight:normal">6</th>
								<th style="font-weight:normal">7</th>
							</tr>
						</thead>
						<tbody>
							<tr>
								<td>Delta Cq</td>
								<td align="center"><italic>18S</italic></td>
								<td align="center"><italic>CASC3</italic></td>
								<td align="center"><italic>ACTB</italic></td>
								<td align="center"><italic>EEFIA2</italic></td>
								<td align="center"><italic>GAPDH</italic></td>
								<td align="center"><italic>HMBS</italic></td>
								<td align="center"><italic>UBC</italic></td>
							</tr>
							<tr>
								<td>BestKeeper</td>
								<td align="center"><italic>EEFIA2</italic></td>
								<td align="center"><italic>GAPDH</italic></td>
								<td align="center"><italic>18S</italic></td>
								<td align="center"><italic>ACTB</italic></td>
								<td align="center"><italic>HMBS</italic></td>
								<td align="center"><italic>CASC3</italic></td>
								<td align="center"><italic>UBC</italic></td>
							</tr>
							<tr>
								<td>NormFinder</td>
								<td align="center"><italic>18S</italic></td>
								<td align="center"><italic>CASC3</italic></td>
								<td align="center"><italic>ACTB</italic></td>
								<td align="center"><italic>GAPDH</italic></td>
								<td align="center"><italic>EEFIA2</italic></td>
								<td align="center"><italic>HMBS</italic></td>
								<td align="center"><italic>UBC</italic></td>
							</tr>
							<tr>
								<td>GeNorm</td>
								<td align="center"><italic>18S | ACTB</italic></td>
								<td> </td>
								<td align="center"><italic>CASC3</italic></td>
								<td align="center"><italic>EEFIA2</italic></td>
								<td align="center"><italic>GAPDH</italic></td>
								<td align="center"><italic>HMBS</italic></td>
								<td align="center"><italic>UBC</italic></td>
							</tr>
							<tr>
								<td>RefFinder</td>
								<td align="center"><italic>18S</italic></td>
								<td align="center"><italic>ACTB</italic></td>
								<td align="center"><italic>CASC3</italic></td>
								<td align="center"><italic>EEFIA2</italic></td>
								<td align="center"><italic>GAPDH</italic></td>
								<td align="center"><italic>HMBS</italic></td>
								<td align="center"><italic>UBC</italic></td>
							</tr>
						</tbody>
					</table>
				</table-wrap>
			</p>
			<p>
				<table-wrap id="t7">
					<label>Table 7</label>
					<caption>
						<title>Ranking of reference genes in the liver of pure- and crossbred animals, regardless of the diet, by the different evaluation methods</title>
					</caption>
					<table frame="hsides" rules="groups">
						<colgroup>
							<col/>
							<col/>
							<col/>
							<col/>
							<col/>
							<col/>
							<col/>
							<col/>
						</colgroup>
						<thead>
							<tr>
								<th align="left" rowspan="2" style="font-weight:normal">Method</th>
								<th colspan="7" style="font-weight:normal">&lt;------- More stable Less stable -------&gt;</th>
							</tr>
							<tr>
								<th style="font-weight:normal">1</th>
								<th style="font-weight:normal">2</th>
								<th style="font-weight:normal">3</th>
								<th style="font-weight:normal">4</th>
								<th style="font-weight:normal">5</th>
								<th style="font-weight:normal">6</th>
								<th style="font-weight:normal">7</th>
							</tr>
						</thead>
						<tbody>
							<tr>
								<td>Delta Cq</td>
								<td align="center"><italic>HMBS</italic></td>
								<td align="center"><italic>ACTB</italic></td>
								<td align="center"><italic>18S</italic></td>
								<td align="center"><italic>GAPDH</italic></td>
								<td align="center"><italic>UBC</italic></td>
								<td align="center"><italic>CASC3</italic></td>
								<td align="center"><italic>EEFIA2</italic></td>
							</tr>
							<tr>
								<td>BestKeeper</td>
								<td align="center"><italic>CASC3</italic></td>
								<td align="center"><italic>18S</italic></td>
								<td align="center"><italic>ACTB</italic></td>
								<td align="center"><italic>HMBS</italic></td>
								<td align="center"><italic>GAPDH</italic></td>
								<td align="center"><italic>UBC</italic></td>
								<td align="center"><italic>EEFIA2</italic></td>
							</tr>
							<tr>
								<td>NormFinder</td>
								<td align="center"><italic>18S</italic></td>
								<td align="center"><italic>HMBS</italic></td>
								<td align="center"><italic>ACTB</italic></td>
								<td align="center"><italic>GAPDH</italic></td>
								<td align="center"><italic>UBC</italic></td>
								<td align="center"><italic>CASC3</italic></td>
								<td align="center"><italic>EEFIA2</italic></td>
							</tr>
							<tr>
								<td>GeNorm</td>
								<td align="center" colspan="2"><italic>ACTB | HMBS</italic></td>
								<td align="center"><italic>GAPDH</italic></td>
								<td align="center"><italic>18S</italic></td>
								<td align="center"><italic>UBC</italic></td>
								<td align="center"><italic>CASC3</italic></td>
								<td align="center"><italic>EEFIA2</italic></td>
							</tr>
							<tr>
								<td>RefFinder</td>
								<td align="center"><italic>HMBS</italic></td>
								<td align="center"><italic>ACTB</italic></td>
								<td align="center"><italic>18S</italic></td>
								<td align="center"><italic>CASC3</italic></td>
								<td align="center"><italic>GAPDH</italic></td>
								<td align="center"><italic>UBC</italic></td>
								<td align="center"><italic>EEFIA2</italic></td>
							</tr>
						</tbody>
					</table>
				</table-wrap>
			</p>
			<p>
				<table-wrap id="t8">
					<label>Table 8</label>
					<caption>
						<title>Ranking of reference genes in the jejunum of pure- and crossbred animals, regardless of the diet, by the different evaluation methods</title>
					</caption>
					<table frame="hsides" rules="groups">
						<colgroup>
							<col/>
							<col/>
							<col/>
							<col/>
							<col/>
							<col/>
							<col/>
							<col/>
						</colgroup>
						<thead>
							<tr>
								<th align="left" rowspan="2" style="font-weight:normal">Method</th>
								<th colspan="7" style="font-weight:normal">&lt;------- More stable Less stable -------&gt;</th>
							</tr>
							<tr>
								<th style="font-weight:normal">1</th>
								<th style="font-weight:normal">2</th>
								<th style="font-weight:normal">3</th>
								<th style="font-weight:normal">4</th>
								<th style="font-weight:normal">5</th>
								<th style="font-weight:normal">6</th>
								<th style="font-weight:normal">7</th>
							</tr>
						</thead>
						<tbody>
							<tr>
								<td>Delta Cq</td>
								<td align="center"><italic>GAPDH</italic></td>
								<td align="center"><italic>ACTB</italic></td>
								<td align="center"><italic>CASC3</italic></td>
								<td align="center"><italic>HMBS</italic></td>
								<td align="center"><italic>18S</italic></td>
								<td align="center"><italic>EEFIA2</italic></td>
								<td align="center"><italic>UBC</italic></td>
							</tr>
							<tr>
								<td>BestKeeper</td>
								<td align="center"><italic>UBC</italic></td>
								<td align="center"><italic>GAPDH</italic></td>
								<td align="center"><italic>CASC3</italic></td>
								<td align="center"><italic>ACTB</italic></td>
								<td align="center"><italic>EEFIA2</italic></td>
								<td align="center"><italic>18S</italic></td>
								<td align="center"><italic>HMBS</italic></td>
							</tr>
							<tr>
								<td>NormFinder</td>
								<td align="center"><italic>GAPDH</italic></td>
								<td align="center"><italic>ACTB</italic></td>
								<td align="center"><italic>CASC3</italic></td>
								<td align="center"><italic>HMBS</italic></td>
								<td align="center"><italic>18S</italic></td>
								<td align="center"><italic>EEFIA2</italic></td>
								<td align="center"><italic>UBC</italic></td>
							</tr>
							<tr>
								<td>GeNorm</td>
								<td align="center" colspan="2"><italic>ACTB | GAPDH</italic></td>
								<td align="center"><italic>CASC3</italic></td>
								<td align="center"><italic>HMBS</italic></td>
								<td align="center"><italic>18S</italic></td>
								<td align="center"><italic>EEFIA2</italic></td>
								<td align="center"><italic>UBC</italic></td>
							</tr>
							<tr>
								<td>RefFinder</td>
								<td align="center"><italic>GAPDH</italic></td>
								<td align="center"><italic>ACTB</italic></td>
								<td align="center"><italic>CASC3</italic></td>
								<td align="center"><italic>UBC</italic></td>
								<td align="center"><italic>HMBS</italic></td>
								<td align="center"><italic>18S</italic></td>
								<td align="center"><italic>EEFIA2</italic></td>
							</tr>
						</tbody>
					</table>
				</table-wrap>
			</p>
		</sec>
		<sec sec-type="discussion">
			<title>4. Discussion</title>
			<p>A reference gene should have expression near the target gene; however, that is not always possible. Thus, the general directives recommend that the Cq values be from 15 to 30 (<xref ref-type="bibr" rid="B37">Wan et al., 2010</xref>). In spite of the wide variation found in the Cq of the genes tested (<xref ref-type="fig" rid="f01">Figure 1</xref>), the values found in this study are at the established interval (15 &lt; Cq &lt; 30), except the <italic>18S</italic> gene. Although it had very low Cq, the <italic>18S</italic> gene was considered stable for muscle and liver according to the RefFinder program.</p>
			<p>In addition, other studies have also found a wide variation in Cq in evaluating reference genes in plants or animals under different experimental conditions (<xref ref-type="bibr" rid="B16">Ling et al., 2014</xref>; <xref ref-type="bibr" rid="B26">Olias et al., 2014</xref>; <xref ref-type="bibr" rid="B30">Robledo et al., 2014</xref>; <xref ref-type="bibr" rid="B8">Gentile et al., 2016</xref>; <xref ref-type="bibr" rid="B6">Die et al., 2017</xref>; <xref ref-type="bibr" rid="B7">Fernandes-Brum et al., 2017</xref>).</p>
			<p>Some studies have already described the selection of reference genes associated with different tissues and conditions in bovines (<xref ref-type="table" rid="t9">Table 9</xref>) and showed that the choice of genes is highly dependent on experimental conditions and that most of the studies were carried out with milk cattle and taurine cattle. <xref ref-type="bibr" rid="B31">Saremi et al. (2012)</xref> found different reference genes recommended for the liver and muscle tissues of bovines fed conjugated linoleic acid (CLA). <xref ref-type="bibr" rid="B17">Lisowski et al. (2008)</xref> evaluated different cattle breeds in different developmental stages and likewise found that two or more reference genes are necessary and that they differ according to the tissue/organ evaluated (liver, kidney, pituitary gland, or thyroid gland).</p>
			<p>
				<table-wrap id="t9">
					<label>Table 9</label>
					<caption>
						<title>Studies carried out on validation of references genes in bovines</title>
					</caption>
					<table frame="hsides" rules="groups">
						<colgroup>
							<col/>
							<col/>
							<col/>
							<col/>
							<col/>
							<col/>
							<col/>
							<col/>
						</colgroup>
						<thead>
							<tr>
								<th align="left" style="font-weight:normal">Animal</th>
								<th style="font-weight:normal">Tissue</th>
								<th style="font-weight:normal">Experimental conditions</th>
								<th style="font-weight:normal">No. of genes tested</th>
								<th style="font-weight:normal">No. of genes for normalization</th>
								<th style="font-weight:normal">More stable genes</th>
								<th style="font-weight:normal">Less stable genes</th>
								<th style="font-weight:normal">Authors</th>
							</tr>
						</thead>
						<tbody>
							<tr>
								<td>Bovine</td>
								<td align="center">Muscle, mammary gland, and liver</td>
								<td align="center">Limousin, Angus, and Blond d’Aquitaine steers and Holstein and Normande cows - difference in physiological status, adiposity, and nutrition</td>
								<td align="center">8</td>
								<td align="center">3 or more</td>
								<td align="center"><italic>UXT, EIF3K</italic>, and <italic>RPLP0</italic></td>
								<td align="center">-</td>
								<td align="center">
									<xref ref-type="bibr" rid="B2">Bonnet et al. (2013)</xref>
								</td>
							</tr>
							<tr>
								<td>Indian cattle</td>
								<td align="center">Blood</td>
								<td align="center">Heat stress</td>
								<td align="center">11</td>
								<td align="center">3</td>
								<td align="center"><italic>RPS15a, B2M</italic>, and <italic>RPS9</italic></td>
								<td align="center"><italic>RPL4</italic></td>
								<td align="center">
									<xref ref-type="bibr" rid="B13">Kishore et al. (2013)</xref>
								</td>
							</tr>
							<tr>
								<td rowspan="3">Dairy cattle</td>
								<td align="center" rowspan="3">Mammary gland, liver, muscle, and fat tissues</td>
								<td align="center" rowspan="3">Dairy cows supplemented with CLA</td>
								<td align="center" rowspan="3">7</td>
								<td align="center" rowspan="3">3 or more</td>
								<td align="center"><italic>EMD, POLR2A</italic>, and <italic>LRP10</italic> in the fat tissues and muscle</td>
								<td align="center" rowspan="3">-</td>
								<td align="center" rowspan="3">
									<xref ref-type="bibr" rid="B31">Saremi et al. (2012)</xref>
								</td>
							</tr>
							<tr>
								<td align="center"><italic>MARVELD1, EMD</italic>, and <italic>LRP10</italic> in the mammary gland</td>
							</tr>
							<tr>
								<td align="center"><italic>HPCAL1, LRP10</italic>, and <italic>E1F3K</italic> in the liver</td>
							</tr>
							<tr>
								<td>Dairy cattle</td>
								<td align="center">Milk somatic cells</td>
								<td align="center">Lactation stages: early (25±5 d in milk), mid (160±15 d in milk), and late (275±25 d in milk) lactation</td>
								<td align="center">9</td>
								<td align="center">4</td>
								<td align="center"><italic>PPP1R11, ACTB, UBC</italic>, and <italic>GAPDH</italic></td>
								<td align="center"><italic>RN18S1</italic></td>
								<td align="center">
									<xref ref-type="bibr" rid="B36">Varshney et al. (2012)</xref>
								</td>
							</tr>
							<tr>
								<td>Bovine</td>
								<td align="center"><italic>Longissimus dorsi</italic> (skeletal muscle)</td>
								<td align="center">20 bovine individuals selected for long- chain omega-3 fatty acids</td>
								<td align="center">10</td>
								<td align="center">3</td>
								<td align="center"><italic>EEF1A2, HMBS</italic>, and <italic>SF3AI</italic></td>
								<td align="center"><italic>GAPDH, 18S</italic>, and <italic>RPII</italic></td>
								<td align="center">
									<xref ref-type="bibr" rid="B28">Pérez et al. (2008)</xref>
								</td>
							</tr>
							<tr>
								<td rowspan="4">Bull of dairy and beef cattle</td>
								<td align="center" rowspan="4">Liver, kidney, pituitary gland, and thyroid gland</td>
								<td align="center" rowspan="4">6-, 9-, and 12-month-old bulls of dairy and beef cattle breeds</td>
								<td align="center" rowspan="4">6</td>
								<td align="center" rowspan="4">2 or more</td>
								<td align="center"><italic>ACTB</italic> and <italic>TBP</italic> in the liver</td>
								<td align="center"><italic>SDHA</italic> and <italic>HPRT1</italic> in the liver</td>
								<td align="center" rowspan="4">
									<xref ref-type="bibr" rid="B17">Lisowski et al. (2008)</xref>
								</td>
							</tr>
							<tr>
								<td align="center"><italic>GAPDH</italic> and <italic>YWHAZ</italic> in the kidney</td>
								<td align="center"><italic>HPRT1</italic> and <italic>TBP</italic> in the kidney</td>
							</tr>
							<tr>
								<td align="center"><italic>GAPDH</italic> and <italic>SDHA</italic> in the pituitary</td>
								<td align="center"><italic>ACTB</italic> and <italic>YWHA2</italic> in the pituitary</td>
							</tr>
							<tr>
								<td align="center"><italic>TBP</italic> and <italic>HPRTI</italic> in the thyroid</td>
								<td align="center"><italic>SDHA</italic> and <italic>GAPDH</italic> in the thyroid</td>
							</tr>
							<tr>
								<td>Dairy cows</td>
								<td align="center">Mammary gland</td>
								<td align="center">During lactation cycle</td>
								<td align="center">9</td>
								<td align="center">3</td>
								<td align="center"><italic>UXT, RPS9</italic>, and <italic>RPS15</italic></td>
								<td align="center"><italic>ACTB</italic> and <italic>GAPDH</italic></td>
								<td align="center">
									<xref ref-type="bibr" rid="B1">Bionaz and Loor (2007)</xref>
								</td>
							</tr>
						</tbody>
					</table>
					<table-wrap-foot>
						<fn id="TFN12">
							<p>N - Nellore; NA - Nellore × Angus; WSC - whole shelled corn; WSCB - whole shelled corn and sugarcane bagasse; B×D - breed and diet interaction; SEM - standard error of the mean.</p>
						</fn>
					</table-wrap-foot>
				</table-wrap>
			</p>
			<p>Studies carried out prior to publication of the Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE guidelines) used only one reference gene (<xref ref-type="bibr" rid="B10">Hamalainen et al., 2001</xref>; <xref ref-type="bibr" rid="B5">Deindl et al., 2002</xref>; <xref ref-type="bibr" rid="B9">Glare et al., 2002</xref>) to normalize RT-qPCR data. However, after its publication, the use of two or more reference genes has been recommended to ensure stable expression under all experimental conditions (<xref ref-type="bibr" rid="B3">Bustin et al., 2009</xref>). In this study, as a consequence of the data analysis by the GeNorm software, the need for at least two, and up to four, reference genes was shown for normalization of the study for the different breeds and diets studied and for the skeletal muscle, liver, and jejunum tissues. Likewise, <xref ref-type="bibr" rid="B28">Pérez et al. (2008)</xref> and <xref ref-type="bibr" rid="B31">Saremi et al. (2012)</xref> showed the need for three genes for muscle; and <xref ref-type="bibr" rid="B17">Lisowski et al. (2008)</xref> and <xref ref-type="bibr" rid="B31">Saremi et al. (2012)</xref> showed the need for two to three reference genes for the liver. However, we did not find studies that investigated the reference genes more suitable for the jejunum of bovines, which is important for studies of gene expression of membrane transport proteins.</p>
			<p>A review of literature regarding reference genes in gene expression studies showed that since the publication of the MIQE, the most common choice of reference genes were <italic>ACTB</italic> (used in 38% of the studies) and <italic>GAPDH</italic> (37%); the <italic>18S</italic> gene (12%) was a little less used in vertebrates (<xref ref-type="bibr" rid="B4">Chapman and Waldenström, 2015</xref>). For the tissues evaluated, at least one of the three genes cited above was stable, making them strong candidates for reference genes in studies with RT-qPCR in zebu cattle and their crosses. The <italic>ACTB</italic> was among the more stable reference genes under all the conditions in this study (<xref ref-type="table" rid="t3">Tables 3-5</xref>). One of the reasons for this is that ACTIN is the most abundant protein in eukaryotic cells (<xref ref-type="bibr" rid="B23">Nakajima-Iijima et al., 1985</xref>). There are at least six ACTIN isoforms in vertebrates: four types in muscle (skeletal, cardiac, vascular smooth, and stomach smooth actins) and two non-muscular types (β-cytoplasmic and γ-cytoplasmic actins) (<xref ref-type="bibr" rid="B34">Vandekerckhove and Weber, 1979</xref>), and they are expressed in all types of tissues, as shown in the results of this study, making this gene an optimal normalizer (<xref ref-type="table" rid="t3">Tables 3-5</xref>).</p>
			<p>The <italic>EEF1A2</italic> gene was considered the least stable reference gene under most of the conditions studied in the liver and jejunum, and <italic>UBC</italic> was the least stable in muscle (<xref ref-type="table" rid="t6">Tables 6-8</xref>). Both are genes expressed under diverse conditions; however, in this study, there was greater variation in relation to the tissues studied. The <italic>EEF1A</italic> gene has two isoforms, <italic>EEF1A1</italic> and <italic>EEF1A2</italic>, that codify the second most abundant protein (after ACTIN) and catalyzes bonding of tRNA to the ribosomal site. The isoform <italic>EEF1A2</italic> is present especially in the brain, heart, and muscle (<xref ref-type="bibr" rid="B15">Lee and Surh, 2009</xref>). The expression of this gene in muscle was greater and more stable, with a mean Cq value of 17.6 (<xref ref-type="fig" rid="f01">Figure 1a</xref>), compared with liver (<xref ref-type="fig" rid="f01">Figure 1b</xref>) and jejunum (<xref ref-type="fig" rid="f01">Figure 1c</xref>) tissues, with mean values of 27 and 26.2, respectively. In the latter two tissues, this gene was selected as one of the three least stable (<xref ref-type="table" rid="t7">Tables 7</xref> and <xref ref-type="table" rid="t8">8</xref>), whereas for muscle, the gene was stable in the purebred and crossbred animals, regardless of the diet fed (<xref ref-type="table" rid="t6">Table 6</xref>).</p>
			<p>In muscle, the <italic>UBC</italic> gene was highly variable in the breeds and diets studied, and thus, it is not considered a good normalizer for this tissue (<xref ref-type="fig" rid="f01">Figure 1a</xref>). A possible explanation for this is that the gene codifies a protein that participates in selective degradation of short-lived proteins in eukaryotic cells and is involved in immune response and cell development and death (<xref ref-type="bibr" rid="B11">Hershko and Ciechanover, 1998</xref>).</p>
			<p>Based on the results that show differences in the stability of candidate reference genes, statistical analyses were performed using the more stable and less stable genes found in this study to reveal possible errors in analysis of gene expression of target genes.</p>
			<p><italic>Fatty Acid Synthase</italic> (<italic>FASN</italic>) and <italic>Acyl-CoA Oxidase 1</italic> (<italic>ACOX</italic>) are genes involved in synthesis and oxidation of saturated fatty acids, and the protein coded by <italic>ACOX</italic> is the first enzyme of beta-oxidation of fatty acids in the peroxisomes (<xref ref-type="bibr" rid="B32">Schulz, 1996</xref>). The gene <italic>FASN</italic>, in its turn, codifies the enzyme responsible for the final steps of <italic>de novo</italic> synthesis of long-chain fatty acids from acetyl-CoA, malonyl-CoA, and NADPH (<xref ref-type="bibr" rid="B14">Ladeira et al., 2016</xref>). When the more stable genes were used for normalization of the study (<xref ref-type="fig" rid="f02">Figure 2</xref>), both <italic>FASN</italic> and <italic>ACOX</italic> target genes in the muscle tissue were more expressed in WSC diets, and <italic>FASN</italic> was also more expressed in crossbred animals. However, upon normalizing the data with the less stable genes, statistical differences were not found for the diets studied, and only tendencies were found for the breeds in both genes. Therefore, these results show that the wrong choice of reference genes would lead to misinterpretation and distortion of results.</p>
			<p>
				<fig id="f02">
					<label>Figure 2</label>
					<caption>
						<title>Expression level of target genes <italic>FASN</italic> and <italic>ACOX</italic> in muscle, normalized by the more stable and less stable reference genes.</title>
					</caption>
					<graphic xlink:href="1806-9290-rbz-51-e20210120-gf02.tif"/>
					<attrib>N - Nellore; NA - Nellore × Angus; WSC - whole shelled corn; WSCB - whole shelled corn and sugarcane bagasse; B×D - breed and diet interaction; SEM - standard error of the mean.</attrib>
				</fig>
			</p>
			<p>The target gene <italic>Stearoyl-CoA Desaturase</italic> (<italic>SCD1</italic>) was evaluated in the liver (<xref ref-type="fig" rid="f03">Figure 3</xref>), and <italic>Maltase-Glucoamylase 2 (MGAM</italic>) and <italic>Solute Carrier Family 2 Member 1</italic> (<italic>SLC2A1</italic>) in the jejunum (<xref ref-type="fig" rid="f04">Figure 4</xref>). The <italic>SCD1</italic> gene is present throughout the organism and is highly expressed in the liver (<xref ref-type="bibr" rid="B25">Ntambi and Miyazaki, 2004</xref>). It is responsible for codifying an enzyme responsible for desaturation of long-chain fatty acids, thus acting in regulation of membrane fluidity (<xref ref-type="bibr" rid="B24">Ntambi et al., 1988</xref>; <xref ref-type="bibr" rid="B25">Ntambi and Miyazaki, 2004</xref>). Evaluation of expression of the <italic>SCD1</italic> gene in the liver showed that upon using the more stable genes, statistical effects of the diets and breeds would not be found. In contrast, with the use of the less stable genes, the inclusion of sugarcane bagasse in the diet would increase expression of the gene in the tissue (<xref ref-type="fig" rid="f03">Figure 3</xref>). In the jejunum, the <italic>MGAM</italic> gene is expressed in the brush border of the small intestine membrane and codifies an enzyme responsible for hydrolyzing maltose into glucose (<xref ref-type="bibr" rid="B21">Mochizuki et al., 2010</xref>). Statistical differences were not found in expression of the <italic>MGAM</italic> gene in the breeds and diets evaluated when the less stable reference genes were used. However, upon using the more stable ones, there was a tendency that the diets containing sugarcane bagasse would result in greater expression of the gene in the jejunum (<xref ref-type="fig" rid="f04">Figure 4</xref>). Finally, the <italic>SLC2A1,</italic> which is expressed in the enterocytes of the small intestine and codifies the sodium-glucose linked transporter (SGLT1), has its expression similar for diets and breeds, regardless of selection of more stable or less stable genes (<xref ref-type="fig" rid="f04">Figure 4</xref>). In this case, there was statistical difference for diets in both groups of reference genes used as normalizers in this study. However, the relative expression with the use of the less stable genes was much greater, which can also lead to poor interpretation of data by authors.</p>
			<p>
				<fig id="f03">
					<label>Figure 3</label>
					<caption>
						<title>Expression level of target gene <italic>SCD1</italic> in the liver, normalized by the more stable and less stable reference genes.</title>
					</caption>
					<graphic xlink:href="1806-9290-rbz-51-e20210120-gf03.tif"/>
					<attrib>N - Nellore; NA - Nellore × Angus; WSC - whole shelled corn; WSCB - whole shelled corn and sugarcane bagasse; B×D - breed and diet interaction; SEM - standard error of the mean.</attrib>
				</fig>
			</p>
			<p>
				<fig id="f04">
					<label>Figure 4</label>
					<caption>
						<title>Expression level of target genes <italic>MGAM</italic> and <italic>SLC2A1</italic> in the jejunum, normalized by the more stable and less stable reference genes.</title>
					</caption>
					<graphic xlink:href="1806-9290-rbz-51-e20210120-gf04.tif"/>
				</fig>
			</p>
			<p>It can be inferred that the choice of reference genes highly affects the results of analyses of gene expression that can occur due to differences brought about under determined metabolic conditions of determined tissues. Thus, there is the possibility of results exhibiting wide variation in gene expression. In the present study, there were few variations in the expression and stability of reference genes among the genetic groups and the diets studied within a specific tissue. However, analysis of the expression of the reference genes among the tissues showed that expressions of <italic>GAPDH</italic> and <italic>EEF1A2</italic> were greater and less stable in muscle compared with the liver and jejunum. Therefore, these genes would likely not be considered ideal for normalization of studies comparing these three tissues.</p>
		</sec>
		<sec sec-type="conclusions">
			<title>5. Conclusions</title>
			<p>The more stable genes for zebu animals and their crosses were <italic>18S, ACTB</italic>, and <italic>CASC3</italic> for muscle tissue; <italic>HMBS, ACTB</italic>, and <italic>18S</italic> for liver tissue; and <italic>GAPDH, ACTB</italic>, and <italic>CASC3</italic> for jejunum tissue, regardless of the breed and diet. Comparison of the more stable and less stable genes as a reference for normalization of target genes shows that the wrong choice of these genes will lead to misleading interpretation of the results.</p>
		</sec>
	</body>
	<back>
		<ack>
			<title>Acknowledgments</title>
			<p>The authors would like to thank Conselho Nacional de Desenvolvimento Científico e Tecnológico (grant number: 457779/2014-4), Fundação de Amparo à Pesquisa do Estado de Minas Gerais (Belo Horizonte, Minas Gerais, Brazil) (grant number: CVZ–PPM: 00441-14), and Cargill (Itapira, São Paulo, Brazil) for funding this study.</p>
		</ack>
		<ref-list>
			<title>References</title>
			<ref id="B1">
				<mixed-citation>Bionaz, M. and Loor, J. J. 2007. Identification of reference genes for quantitative real-time PCR in the bovine mammary gland during the lactation cycle. Physiological Genomics 29:312-319. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1152/physiolgenomics.00223.2006">https://doi.org/10.1152/physiolgenomics.00223.2006</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Bionaz</surname>
							<given-names>M.</given-names>
						</name>
						<name>
							<surname>Loor</surname>
							<given-names>J. J.</given-names>
						</name>
					</person-group>
					<year>2007</year>
					<article-title>Identification of reference genes for quantitative real-time PCR in the bovine mammary gland during the lactation cycle</article-title>
					<source>Physiological Genomics</source>
					<volume>29</volume>
					<fpage>312</fpage>
					<lpage>319</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1152/physiolgenomics.00223.2006">https://doi.org/10.1152/physiolgenomics.00223.2006</ext-link>
					</comment>
				</element-citation>
			</ref>
			<ref id="B2">
				<mixed-citation>Bonnet, M.; Bernard, L.; Bes, S. and Leroux, C. 2013. Selection of reference genes for quantitative real-time PCR normalisation in adipose tissue, muscle, liver and mammary gland from ruminants. Animal 7:1344-1353. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1017/S1751731113000475">https://doi.org/10.1017/S1751731113000475</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Bonnet</surname>
							<given-names>M.</given-names>
						</name>
						<name>
							<surname>Bernard</surname>
							<given-names>L.</given-names>
						</name>
						<name>
							<surname>Bes</surname>
							<given-names>S.</given-names>
						</name>
						<name>
							<surname>Leroux</surname>
							<given-names>C.</given-names>
						</name>
					</person-group>
					<year>2013</year>
					<article-title>Selection of reference genes for quantitative real-time PCR normalisation in adipose tissue, muscle, liver and mammary gland from ruminants</article-title>
					<source>Animal</source>
					<volume>7</volume>
					<fpage>1344</fpage>
					<lpage>1353</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1017/S1751731113000475">https://doi.org/10.1017/S1751731113000475</ext-link>
					</comment>
				</element-citation>
			</ref>
			<ref id="B3">
				<mixed-citation>Bustin, S. A.; Benes, V.; Garson, J. A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M. W.; Shipley, G. L.; Vandesompele, J. and Wittwer, C. T. 2009. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clinical Chemistry 55:611-622. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1373/clinchem.2008.112797">https://doi.org/10.1373/clinchem.2008.112797</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Bustin</surname>
							<given-names>S. A.</given-names>
						</name>
						<name>
							<surname>Benes</surname>
							<given-names>V.</given-names>
						</name>
						<name>
							<surname>Garson</surname>
							<given-names>J. A.</given-names>
						</name>
						<name>
							<surname>Hellemans</surname>
							<given-names>J.</given-names>
						</name>
						<name>
							<surname>Huggett</surname>
							<given-names>J.</given-names>
						</name>
						<name>
							<surname>Kubista</surname>
							<given-names>M.</given-names>
						</name>
						<name>
							<surname>Mueller</surname>
							<given-names>R.</given-names>
						</name>
						<name>
							<surname>Nolan</surname>
							<given-names>T.</given-names>
						</name>
						<name>
							<surname>Pfaffl</surname>
							<given-names>M. W.</given-names>
						</name>
						<name>
							<surname>Shipley</surname>
							<given-names>G. L.</given-names>
						</name>
						<name>
							<surname>Vandesompele</surname>
							<given-names>J.</given-names>
						</name>
						<name>
							<surname>Wittwer</surname>
							<given-names>C. T.</given-names>
						</name>
					</person-group>
					<year>2009</year>
					<article-title>The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments</article-title>
					<source>Clinical Chemistry</source>
					<volume>55</volume>
					<fpage>611</fpage>
					<lpage>622</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1373/clinchem.2008.112797">https://doi.org/10.1373/clinchem.2008.112797</ext-link>
					</comment>
				</element-citation>
			</ref>
			<ref id="B4">
				<mixed-citation>Chapman, J. R. and Waldenström, J. 2015. With reference to reference genes: a systematic review of endogenous controls in gene expression studies. PLoS One 10:e0141853. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1371/journal.pone.0141853">https://doi.org/10.1371/journal.pone.0141853</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Chapman</surname>
							<given-names>J. R.</given-names>
						</name>
						<name>
							<surname>Waldenström</surname>
							<given-names>J.</given-names>
						</name>
					</person-group>
					<year>2015</year>
					<article-title>With reference to reference genes: a systematic review of endogenous controls in gene expression studies</article-title>
					<source>PLoS One</source>
					<volume>10</volume>
					<elocation-id>e0141853</elocation-id>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1371/journal.pone.0141853">https://doi.org/10.1371/journal.pone.0141853</ext-link>
					</comment>
				</element-citation>
			</ref>
			<ref id="B5">
				<mixed-citation>Deindl, E.; Boengler, K.; van Royen, N. and Schaper, W. 2002. Differential expression of GAPDH and β-actin in growing collateral arteries. Molecular and Cellular Biochemistry 236:139-146. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1023/A:1016166127465">https://doi.org/10.1023/A:1016166127465</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Deindl</surname>
							<given-names>E.</given-names>
						</name>
						<name>
							<surname>Boengler</surname>
							<given-names>K.</given-names>
						</name>
						<name>
							<surname>van Royen</surname>
							<given-names>N.</given-names>
						</name>
						<name>
							<surname>Schaper</surname>
							<given-names>W.</given-names>
						</name>
					</person-group>
					<year>2002</year>
					<article-title>Differential expression of GAPDH and β-actin in growing collateral arteries</article-title>
					<source>Molecular and Cellular Biochemistry</source>
					<volume>236</volume>
					<fpage>139</fpage>
					<lpage>146</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1023/A:1016166127465">https://doi.org/10.1023/A:1016166127465</ext-link>
					</comment>
				</element-citation>
			</ref>
			<ref id="B6">
				<mixed-citation>Die, J. V.; Baldwin, R. L.; Rowland, L. J.; Li, R.; Oh, S.; Li, C.; Connor, E. E. and Ranilla, M.-J. 2017. Selection of internal reference genes for normalization of reverse transcription quantitative polymerase chain reaction (RT-qPCR) analysis in the rumen epithelium. PLoS One 12:e0172674. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1371/journal.pone.0172674">https://doi.org/10.1371/journal.pone.0172674</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Die</surname>
							<given-names>J. V.</given-names>
						</name>
						<name>
							<surname>Baldwin</surname>
							<given-names>R. L.</given-names>
						</name>
						<name>
							<surname>Rowland</surname>
							<given-names>L. J.</given-names>
						</name>
						<name>
							<surname>Li</surname>
							<given-names>R.</given-names>
						</name>
						<name>
							<surname>Oh</surname>
							<given-names>S.</given-names>
						</name>
						<name>
							<surname>Li</surname>
							<given-names>C.</given-names>
						</name>
						<name>
							<surname>Connor</surname>
							<given-names>E. E.</given-names>
						</name>
						<name>
							<surname>Ranilla</surname>
							<given-names>M.-J.</given-names>
						</name>
					</person-group>
					<year>2017</year>
					<article-title>Selection of internal reference genes for normalization of reverse transcription quantitative polymerase chain reaction (RT-qPCR) analysis in the rumen epithelium</article-title>
					<source>PLoS One</source>
					<volume>12</volume>
					<elocation-id>e0172674</elocation-id>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1371/journal.pone.0172674">https://doi.org/10.1371/journal.pone.0172674</ext-link>
					</comment>
				</element-citation>
			</ref>
			<ref id="B7">
				<mixed-citation>Fernandes-Brum, C. N.; Garcia, B. O.; Moreira, R. O.; Ságio, S. A.; Barreto, H. G.; Lima, A. A.; Freitas, N. C.; Lima, R. R.; Carvalho, C. H. S. and Chalfun-Júnior, A. 2017. A panel of the most suitable reference genes for RT-qPCR expression studies of coffee: screening their stability under different conditions. Tree Genetics &amp; Genomes 13:131. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1007/s11295-017-1213-1">https://doi.org/10.1007/s11295-017-1213-1</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Fernandes-Brum</surname>
							<given-names>C. N.</given-names>
						</name>
						<name>
							<surname>Garcia</surname>
							<given-names>B. O.</given-names>
						</name>
						<name>
							<surname>Moreira</surname>
							<given-names>R. O.</given-names>
						</name>
						<name>
							<surname>Ságio</surname>
							<given-names>S. A.</given-names>
						</name>
						<name>
							<surname>Barreto</surname>
							<given-names>H. G.</given-names>
						</name>
						<name>
							<surname>Lima</surname>
							<given-names>A. A.</given-names>
						</name>
						<name>
							<surname>Freitas</surname>
							<given-names>N. C.</given-names>
						</name>
						<name>
							<surname>Lima</surname>
							<given-names>R. R.</given-names>
						</name>
						<name>
							<surname>Carvalho</surname>
							<given-names>C. H. S.</given-names>
						</name>
						<name>
							<surname>Chalfun-Júnior</surname>
							<given-names>A.</given-names>
						</name>
					</person-group>
					<year>2017</year>
					<article-title>A panel of the most suitable reference genes for RT-qPCR expression studies of coffee: screening their stability under different conditions</article-title>
					<source>Tree Genetics &amp; Genomes</source>
					<volume>13</volume>
					<size units="pages">131</size>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1007/s11295-017-1213-1">https://doi.org/10.1007/s11295-017-1213-1</ext-link>
					</comment>
				</element-citation>
			</ref>
			<ref id="B8">
				<mixed-citation>Gentile, A.-M.; Lhamyani, S.; Coín-Aragüez, L.; Oliva-Olivera, W.; Zayed, H.; Vega-Rioja, A.; Monteseirin, J.; Romero-Zerbo, S.-Y.; Tinahones, F.-J.; Bermúdez-Silva, F.-J. and El Bekay, R. 2016. RPL13A and EEF1A1 are suitable reference genes for qPCR during adipocyte differentiation of vascular stromal cells from patients with different BMI and HOMA-IR. PLoS One 11:e0157002. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1371/journal.pone.0157002">https://doi.org/10.1371/journal.pone.0157002</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Gentile</surname>
							<given-names>A.-M.</given-names>
						</name>
						<name>
							<surname>Lhamyani</surname>
							<given-names>S.</given-names>
						</name>
						<name>
							<surname>Coín-Aragüez</surname>
							<given-names>L.</given-names>
						</name>
						<name>
							<surname>Oliva-Olivera</surname>
							<given-names>W.</given-names>
						</name>
						<name>
							<surname>Zayed</surname>
							<given-names>H.</given-names>
						</name>
						<name>
							<surname>Vega-Rioja</surname>
							<given-names>A.</given-names>
						</name>
						<name>
							<surname>Monteseirin</surname>
							<given-names>J.</given-names>
						</name>
						<name>
							<surname>Romero-Zerbo</surname>
							<given-names>S.-Y.</given-names>
						</name>
						<name>
							<surname>Tinahones</surname>
							<given-names>F.-J.</given-names>
						</name>
						<name>
							<surname>Bermúdez-Silva</surname>
							<given-names>F.-J.</given-names>
						</name>
						<name>
							<surname>El Bekay</surname>
							<given-names>R.</given-names>
						</name>
					</person-group>
					<year>2016</year>
					<article-title>RPL13A and EEF1A1 are suitable reference genes for qPCR during adipocyte differentiation of vascular stromal cells from patients with different BMI and HOMA-IR</article-title>
					<source>PLoS One</source>
					<volume>11</volume>
					<elocation-id>e0157002</elocation-id>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1371/journal.pone.0157002">https://doi.org/10.1371/journal.pone.0157002</ext-link>
					</comment>
				</element-citation>
			</ref>
			<ref id="B9">
				<mixed-citation>Glare, E. M.; Divjak, M.; Bailey, M. J. and Walters, E. H. 2002. β-Actin and GAPDH housekeeping gene expression in asthmatic airways is variable and not suitable for normalising mRNA levels. Thorax 57:765-770. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1136/thorax.57.9.765">https://doi.org/10.1136/thorax.57.9.765</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Glare</surname>
							<given-names>E. M.</given-names>
						</name>
						<name>
							<surname>Divjak</surname>
							<given-names>M.</given-names>
						</name>
						<name>
							<surname>Bailey</surname>
							<given-names>M. J.</given-names>
						</name>
						<name>
							<surname>Walters</surname>
							<given-names>E. H.</given-names>
						</name>
					</person-group>
					<year>2002</year>
					<article-title>β-Actin and GAPDH housekeeping gene expression in asthmatic airways is variable and not suitable for normalising mRNA levels</article-title>
					<source>Thorax</source>
					<volume>57</volume>
					<fpage>765</fpage>
					<lpage>770</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1136/thorax.57.9.765">https://doi.org/10.1136/thorax.57.9.765</ext-link>
					</comment>
				</element-citation>
			</ref>
			<ref id="B10">
				<mixed-citation>Hamalainen, H. K.; Tubman, J. C.; Vikman, S.; Kyrölä, T.; Ylikoski, E.; Warrington, J. A. and Lahesmaa, R. 2001. Identification and validation of endogenous reference genes for expression profiling of T helper cell differentiation by quantitative real-time RT-PCR. Analytical Biochemistry 299:63-70. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1006/abio.2001.5369">https://doi.org/10.1006/abio.2001.5369</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Hamalainen</surname>
							<given-names>H. K.</given-names>
						</name>
						<name>
							<surname>Tubman</surname>
							<given-names>J. C.</given-names>
						</name>
						<name>
							<surname>Vikman</surname>
							<given-names>S.</given-names>
						</name>
						<name>
							<surname>Kyrölä</surname>
							<given-names>T.</given-names>
						</name>
						<name>
							<surname>Ylikoski</surname>
							<given-names>E.</given-names>
						</name>
						<name>
							<surname>Warrington</surname>
							<given-names>J. A.</given-names>
						</name>
						<name>
							<surname>Lahesmaa</surname>
							<given-names>R.</given-names>
						</name>
					</person-group>
					<year>2001</year>
					<article-title>Identification and validation of endogenous reference genes for expression profiling of T helper cell differentiation by quantitative real-time RT-PCR</article-title>
					<source>Analytical Biochemistry</source>
					<volume>299</volume>
					<fpage>63</fpage>
					<lpage>70</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1006/abio.2001.5369">https://doi.org/10.1006/abio.2001.5369</ext-link>
					</comment>
				</element-citation>
			</ref>
			<ref id="B11">
				<mixed-citation>Hershko, A. and Ciechanover, A. 1998. The Unibiquitin System. Annual Review of Biochemistry 67:425-479. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1146/annurev.biochem.67.1.425">https://doi.org/10.1146/annurev.biochem.67.1.425</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Hershko</surname>
							<given-names>A.</given-names>
						</name>
						<name>
							<surname>Ciechanover</surname>
							<given-names>A.</given-names>
						</name>
					</person-group>
					<year>1998</year>
					<article-title>The Unibiquitin System</article-title>
					<source>Annual Review of Biochemistry</source>
					<volume>67</volume>
					<fpage>425</fpage>
					<lpage>479</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1146/annurev.biochem.67.1.425">https://doi.org/10.1146/annurev.biochem.67.1.425</ext-link>
					</comment>
				</element-citation>
			</ref>
			<ref id="B12">
				<mixed-citation>Kaur, R.; Sodhi, M.; Sharma, A.; Sharma, V. L.; Verma, P.; Swami, S. K.; Kumari, P. and Mukesh, M. 2018. Selection of suitable reference genes for normalization of quantitative RT-PCR (RT-qPCR) expression data across twelve tissues of riverine buffaloes (Bubalus bubalis). PLoS One 13:e0191558. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1371/journal.pone.0191558">https://doi.org/10.1371/journal.pone.0191558</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Kaur</surname>
							<given-names>R.</given-names>
						</name>
						<name>
							<surname>Sodhi</surname>
							<given-names>M.</given-names>
						</name>
						<name>
							<surname>Sharma</surname>
							<given-names>A.</given-names>
						</name>
						<name>
							<surname>Sharma</surname>
							<given-names>V. L.</given-names>
						</name>
						<name>
							<surname>Verma</surname>
							<given-names>P.</given-names>
						</name>
						<name>
							<surname>Swami</surname>
							<given-names>S. K.</given-names>
						</name>
						<name>
							<surname>Kumari</surname>
							<given-names>P.</given-names>
						</name>
						<name>
							<surname>Mukesh</surname>
							<given-names>M.</given-names>
						</name>
					</person-group>
					<year>2018</year>
					<article-title>Selection of suitable reference genes for normalization of quantitative RT-PCR (RT-qPCR) expression data across twelve tissues of riverine buffaloes (Bubalus bubalis)</article-title>
					<source>PLoS One</source>
					<volume>13</volume>
					<elocation-id>e0191558</elocation-id>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1371/journal.pone.0191558">https://doi.org/10.1371/journal.pone.0191558</ext-link>
					</comment>
				</element-citation>
			</ref>
			<ref id="B13">
				<mixed-citation>Kishore, A.; Sodhi, M.; Khate, K.; Kapila, N.; Kumari, P. and Mukesh, M. 2013. Selection of stable reference genes in heat stressed peripheral blood mononuclear cells of tropically adapted Indian cattle and buffaloes. Molecular and Cellular Probes 27:140-144. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1016/j.mcp.2013.02.003">https://doi.org/10.1016/j.mcp.2013.02.003</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Kishore</surname>
							<given-names>A.</given-names>
						</name>
						<name>
							<surname>Sodhi</surname>
							<given-names>M.</given-names>
						</name>
						<name>
							<surname>Khate</surname>
							<given-names>K.</given-names>
						</name>
						<name>
							<surname>Kapila</surname>
							<given-names>N.</given-names>
						</name>
						<name>
							<surname>Kumari</surname>
							<given-names>P.</given-names>
						</name>
						<name>
							<surname>Mukesh</surname>
							<given-names>M.</given-names>
						</name>
					</person-group>
					<year>2013</year>
					<article-title>Selection of stable reference genes in heat stressed peripheral blood mononuclear cells of tropically adapted Indian cattle and buffaloes</article-title>
					<source>Molecular and Cellular Probes</source>
					<volume>27</volume>
					<fpage>140</fpage>
					<lpage>144</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1016/j.mcp.2013.02.003">https://doi.org/10.1016/j.mcp.2013.02.003</ext-link>
					</comment>
				</element-citation>
			</ref>
			<ref id="B14">
				<mixed-citation>Ladeira, M. M.; Schoonmaker, J. P.; Gionbelli, M. P.; Dias, J. C. O.; Gionbelli, T. R. S.; Carvalho, J. R. R. and Teixeira, P. D. 2016. Nutrigenomics and beef quality: A review about lipogenesis. International Journal of Molecular Sciences 17:918. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3390/ijms17060918">https://doi.org/10.3390/ijms17060918</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Ladeira</surname>
							<given-names>M. M.</given-names>
						</name>
						<name>
							<surname>Schoonmaker</surname>
							<given-names>J. P.</given-names>
						</name>
						<name>
							<surname>Gionbelli</surname>
							<given-names>M. P.</given-names>
						</name>
						<name>
							<surname>Dias</surname>
							<given-names>J. C. O.</given-names>
						</name>
						<name>
							<surname>Gionbelli</surname>
							<given-names>T. R. S.</given-names>
						</name>
						<name>
							<surname>Carvalho</surname>
							<given-names>J. R. R.</given-names>
						</name>
						<name>
							<surname>Teixeira</surname>
							<given-names>P. D.</given-names>
						</name>
					</person-group>
					<year>2016</year>
					<article-title>Nutrigenomics and beef quality: A review about lipogenesis</article-title>
					<source>International Journal of Molecular Sciences</source>
					<volume>17</volume>
					<size units="pages">918</size>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3390/ijms17060918">https://doi.org/10.3390/ijms17060918</ext-link>
					</comment>
				</element-citation>
			</ref>
			<ref id="B15">
				<mixed-citation>Lee, M. H. and Surh, Y. J. 2009. eEF1A2 as a putative oncogene. Annals of the New York Academy of Sciences 1171:87-93. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1111/j.1749-6632.2009.04909.x">https://doi.org/10.1111/j.1749-6632.2009.04909.x</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Lee</surname>
							<given-names>M. H.</given-names>
						</name>
						<name>
							<surname>Surh</surname>
							<given-names>Y. J.</given-names>
						</name>
					</person-group>
					<year>2009</year>
					<article-title>eEF1A2 as a putative oncogene</article-title>
					<source>Annals of the New York Academy of Sciences</source>
					<volume>1171</volume>
					<fpage>87</fpage>
					<lpage>93</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1111/j.1749-6632.2009.04909.x">https://doi.org/10.1111/j.1749-6632.2009.04909.x</ext-link>
					</comment>
				</element-citation>
			</ref>
			<ref id="B16">
				<mixed-citation>Ling, H.; Wu, Q.; Guo, J.; Xu, L. and Que, Y. 2014. Comprehensive selection of reference genes for gene expression normalization in sugarcane by real time quantitative RT-PCR. PLoS One 9:e97469. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1371/journal.pone.0097469">https://doi.org/10.1371/journal.pone.0097469</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Ling</surname>
							<given-names>H.</given-names>
						</name>
						<name>
							<surname>Wu</surname>
							<given-names>Q.</given-names>
						</name>
						<name>
							<surname>Guo</surname>
							<given-names>J.</given-names>
						</name>
						<name>
							<surname>Xu</surname>
							<given-names>L.</given-names>
						</name>
						<name>
							<surname>Que</surname>
							<given-names>Y.</given-names>
						</name>
					</person-group>
					<year>2014</year>
					<article-title>Comprehensive selection of reference genes for gene expression normalization in sugarcane by real time quantitative RT-PCR</article-title>
					<source>PLoS One</source>
					<volume>9</volume>
					<elocation-id>e97469</elocation-id>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1371/journal.pone.0097469">https://doi.org/10.1371/journal.pone.0097469</ext-link>
					</comment>
				</element-citation>
			</ref>
			<ref id="B17">
				<mixed-citation>Lisowski, P.; Pierzchała, M.; Gościk, J.; Pareek, C. S. and Zwierzchowski, L. 2008. Evaluation of reference genes for studies of gene expression in the bovine liver, kidney, pituitary, and thyroid. Journal of Applied Genetics 49:367-372. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1007/bf03195635">https://doi.org/10.1007/bf03195635</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Lisowski</surname>
							<given-names>P.</given-names>
						</name>
						<name>
							<surname>Pierzchała</surname>
							<given-names>M.</given-names>
						</name>
						<name>
							<surname>Gościk</surname>
							<given-names>J.</given-names>
						</name>
						<name>
							<surname>Pareek</surname>
							<given-names>C. S.</given-names>
						</name>
						<name>
							<surname>Zwierzchowski</surname>
							<given-names>L.</given-names>
						</name>
					</person-group>
					<year>2008</year>
					<article-title>Evaluation of reference genes for studies of gene expression in the bovine liver, kidney, pituitary, and thyroid</article-title>
					<source>Journal of Applied Genetics</source>
					<volume>49</volume>
					<fpage>367</fpage>
					<lpage>372</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1007/bf03195635">https://doi.org/10.1007/bf03195635</ext-link>
					</comment>
				</element-citation>
			</ref>
			<ref id="B18">
				<mixed-citation>Lopes, R. C.; Sampaio, C. B.; Trece, A. S.; Teixeira, P. D.; Gionbelli, T. R. S.; Santos, L. R.; Costa, T. C.; Duarte, M. S. and Gionbelli, M. P. 2020. Impacts of protein supplementation during late gestation of beef cows on maternal skeletal muscle and liver tissues metabolism. Animal 14:1867-1875. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1017/S1751731120000336">https://doi.org/10.1017/S1751731120000336</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Lopes</surname>
							<given-names>R. C.</given-names>
						</name>
						<name>
							<surname>Sampaio</surname>
							<given-names>C. B.</given-names>
						</name>
						<name>
							<surname>Trece</surname>
							<given-names>A. S.</given-names>
						</name>
						<name>
							<surname>Teixeira</surname>
							<given-names>P. D.</given-names>
						</name>
						<name>
							<surname>Gionbelli</surname>
							<given-names>T. R. S.</given-names>
						</name>
						<name>
							<surname>Santos</surname>
							<given-names>L. R.</given-names>
						</name>
						<name>
							<surname>Costa</surname>
							<given-names>T. C.</given-names>
						</name>
						<name>
							<surname>Duarte</surname>
							<given-names>M. S.</given-names>
						</name>
						<name>
							<surname>Gionbelli</surname>
							<given-names>M. P.</given-names>
						</name>
					</person-group>
					<year>2020</year>
					<article-title>Impacts of protein supplementation during late gestation of beef cows on maternal skeletal muscle and liver tissues metabolism</article-title>
					<source>Animal</source>
					<volume>14</volume>
					<fpage>1867</fpage>
					<lpage>1875</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1017/S1751731120000336">https://doi.org/10.1017/S1751731120000336</ext-link>
					</comment>
				</element-citation>
			</ref>
			<ref id="B19">
				<mixed-citation>Lozano-Villegas, K. J.; Rodríguez-Hernández, R.; Herrera-Sánchez, M. P.; Uribe-García, H. F.; Naranjo-Gómez, J. S.; Otero-Arroyo, R. J. and Rondón-Barragán, I. S. 2021. Identification of reference genes for expression studies in the whole-blood from three cattle breeds under two states of livestock weather safety. Animals 11:3073. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3390/ani11113073">https://doi.org/10.3390/ani11113073</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Lozano-Villegas</surname>
							<given-names>K. J.</given-names>
						</name>
						<name>
							<surname>Rodríguez-Hernández</surname>
							<given-names>R.</given-names>
						</name>
						<name>
							<surname>Herrera-Sánchez</surname>
							<given-names>M. P.</given-names>
						</name>
						<name>
							<surname>Uribe-García</surname>
							<given-names>H. F.</given-names>
						</name>
						<name>
							<surname>Naranjo-Gómez</surname>
							<given-names>J. S.</given-names>
						</name>
						<name>
							<surname>Otero-Arroyo</surname>
							<given-names>R. J.</given-names>
						</name>
						<name>
							<surname>Rondón-Barragán</surname>
							<given-names>I. S.</given-names>
						</name>
					</person-group>
					<year>2021</year>
					<article-title>Identification of reference genes for expression studies in the whole-blood from three cattle breeds under two states of livestock weather safety</article-title>
					<source>Animals</source>
					<volume>11</volume>
					<size units="pages">3073</size>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3390/ani11113073">https://doi.org/10.3390/ani11113073</ext-link>
					</comment>
				</element-citation>
			</ref>
			<ref id="B20">
				<mixed-citation>Mberema, C. H. H. and Sparagano, O. A. E. 2017. Expression stability of reference genes in the skeletal muscles of beef cattle. African Journal of Biotechnology 16:261-267. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.5897/AJB2016.15140">https://doi.org/10.5897/AJB2016.15140</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Mberema</surname>
							<given-names>C. H. H.</given-names>
						</name>
						<name>
							<surname>Sparagano</surname>
							<given-names>O. A. E.</given-names>
						</name>
					</person-group>
					<year>2017</year>
					<article-title>Expression stability of reference genes in the skeletal muscles of beef cattle</article-title>
					<source>African Journal of Biotechnology</source>
					<volume>16</volume>
					<fpage>261</fpage>
					<lpage>267</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.5897/AJB2016.15140">https://doi.org/10.5897/AJB2016.15140</ext-link>
					</comment>
				</element-citation>
			</ref>
			<ref id="B21">
				<mixed-citation>Mochizuki, K.; Honma, K.; Shimada, M. and Goda, T. 2010. The regulation of jejunal induction of the maltase–glucoamylase gene by a high‐starch/low‐fat diet in mice. Molecular Nutrition &amp; Food Research 54:1445-1451. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1002/mnfr.200900467">https://doi.org/10.1002/mnfr.200900467</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Mochizuki</surname>
							<given-names>K.</given-names>
						</name>
						<name>
							<surname>Honma</surname>
							<given-names>K.</given-names>
						</name>
						<name>
							<surname>Shimada</surname>
							<given-names>M.</given-names>
						</name>
						<name>
							<surname>Goda</surname>
							<given-names>T.</given-names>
						</name>
					</person-group>
					<year>2010</year>
					<article-title>The regulation of jejunal induction of the maltase–glucoamylase gene by a high‐starch/low‐fat diet in mice</article-title>
					<source>Molecular Nutrition &amp; Food Research</source>
					<volume>54</volume>
					<fpage>1445</fpage>
					<lpage>1451</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1002/mnfr.200900467">https://doi.org/10.1002/mnfr.200900467</ext-link>
					</comment>
				</element-citation>
			</ref>
			<ref id="B22">
				<mixed-citation>Muhaghegh-Dolatabady, M.; Hossainy-Dolatabady, H.; Heidari Arjlo, E. and Mahmoudi, R. 2017. Validation of reference genes for real time PCR normalization in milk somatic cells of Holstein dairy cattle. Iranian Journal of Applied Animal Science 7:229-234.</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Muhaghegh-Dolatabady</surname>
							<given-names>M.</given-names>
						</name>
						<name>
							<surname>Hossainy-Dolatabady</surname>
							<given-names>H.</given-names>
						</name>
						<name>
							<surname>Heidari Arjlo</surname>
							<given-names>E.</given-names>
						</name>
						<name>
							<surname>Mahmoudi</surname>
							<given-names>R.</given-names>
						</name>
					</person-group>
					<year>2017</year>
					<article-title>Validation of reference genes for real time PCR normalization in milk somatic cells of Holstein dairy cattle</article-title>
					<source>Iranian Journal of Applied Animal Science</source>
					<volume>7</volume>
					<fpage>229</fpage>
					<lpage>234</lpage>
				</element-citation>
			</ref>
			<ref id="B23">
				<mixed-citation>Nakajima-Iijima, S.; Hamada, H.; Reddy, P. and Kakunaga, T. 1985. Molecular structure of the human cytoplasmic beta-actin gene: interspecies homology of sequences in the introns. Proceedings of the National Academy of Sciences of the United States of America 82:6133-6137. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1073/pnas.82.18.6133">https://doi.org/10.1073/pnas.82.18.6133</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Nakajima-Iijima</surname>
							<given-names>S.</given-names>
						</name>
						<name>
							<surname>Hamada</surname>
							<given-names>H.</given-names>
						</name>
						<name>
							<surname>Reddy</surname>
							<given-names>P.</given-names>
						</name>
						<name>
							<surname>Kakunaga</surname>
							<given-names>T.</given-names>
						</name>
					</person-group>
					<year>1985</year>
					<article-title>Molecular structure of the human cytoplasmic beta-actin gene: interspecies homology of sequences in the introns</article-title>
					<source>Proceedings of the National Academy of Sciences of the United States of America</source>
					<volume>82</volume>
					<fpage>6133</fpage>
					<lpage>6137</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1073/pnas.82.18.6133">https://doi.org/10.1073/pnas.82.18.6133</ext-link>
					</comment>
				</element-citation>
			</ref>
			<ref id="B24">
				<mixed-citation>Ntambi, J. M.; Buhrow, S. A.; Kaestner, K. H.; Christy, R. J.; Sibley, E.; Kelly, T. J. and Lane, M. D. 1988. Differentiation-induced gene expression in 3T3-L1 preadipocytes. Characterization of a differentially expressed gene encoding stearoyl-CoA desaturase. Journal of Biological Chemistry 263:17291-17300. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1016/S0021-9258(19)77834-X">https://doi.org/10.1016/S0021-9258(19)77834-X</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Ntambi</surname>
							<given-names>J. M.</given-names>
						</name>
						<name>
							<surname>Buhrow</surname>
							<given-names>S. A.</given-names>
						</name>
						<name>
							<surname>Kaestner</surname>
							<given-names>K. H.</given-names>
						</name>
						<name>
							<surname>Christy</surname>
							<given-names>R. J.</given-names>
						</name>
						<name>
							<surname>Sibley</surname>
							<given-names>E.</given-names>
						</name>
						<name>
							<surname>Kelly</surname>
							<given-names>T. J.</given-names>
						</name>
						<name>
							<surname>Lane</surname>
							<given-names>M. D.</given-names>
						</name>
					</person-group>
					<year>1988</year>
					<article-title>Differentiation-induced gene expression in 3T3-L1 preadipocytes. Characterization of a differentially expressed gene encoding stearoyl-CoA desaturase</article-title>
					<source>Journal of Biological Chemistry</source>
					<volume>263</volume>
					<fpage>17291</fpage>
					<lpage>17300</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1016/S0021-9258(19)77834-X">https://doi.org/10.1016/S0021-9258(19)77834-X</ext-link>
					</comment>
				</element-citation>
			</ref>
			<ref id="B25">
				<mixed-citation>Ntambi, J. M. and Miyazaki, M. 2004. Regulation of stearoyl-CoA desaturases and role in metabolism. Progress in Lipid Research 43:91-104. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1016/S0163-7827(03)00039-0">https://doi.org/10.1016/S0163-7827(03)00039-0</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Ntambi</surname>
							<given-names>J. M.</given-names>
						</name>
						<name>
							<surname>Miyazaki</surname>
							<given-names>M.</given-names>
						</name>
					</person-group>
					<year>2004</year>
					<article-title>Regulation of stearoyl-CoA desaturases and role in metabolism</article-title>
					<source>Progress in Lipid Research</source>
					<volume>43</volume>
					<fpage>91</fpage>
					<lpage>104</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1016/S0163-7827(03)00039-0">https://doi.org/10.1016/S0163-7827(03)00039-0</ext-link>
					</comment>
				</element-citation>
			</ref>
			<ref id="B26">
				<mixed-citation>Olias, P.; Adam, I.; Meyer, A.; Scharff, C. and Gruber, A. D. 2014. Reference genes for quantitative gene expression studies in multiple avian species. PLoS One 9:e99678. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1371/journal.pone.0099678">https://doi.org/10.1371/journal.pone.0099678</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Olias</surname>
							<given-names>P.</given-names>
						</name>
						<name>
							<surname>Adam</surname>
							<given-names>I.</given-names>
						</name>
						<name>
							<surname>Meyer</surname>
							<given-names>A.</given-names>
						</name>
						<name>
							<surname>Scharff</surname>
							<given-names>C.</given-names>
						</name>
						<name>
							<surname>Gruber</surname>
							<given-names>A. D.</given-names>
						</name>
					</person-group>
					<year>2014</year>
					<article-title>Reference genes for quantitative gene expression studies in multiple avian species</article-title>
					<source>PLoS One</source>
					<volume>9</volume>
					<elocation-id>e99678</elocation-id>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1371/journal.pone.0099678">https://doi.org/10.1371/journal.pone.0099678</ext-link>
					</comment>
				</element-citation>
			</ref>
			<ref id="B27">
				<mixed-citation>Oliveira, D. M.; Chalfun-Junior, A.; Chizzotti, M. L.; Barreto, H. G.; Coelho, T. C.; Paiva, L. V.; Coelho, C. P.; Teixeira, P. D.; Schoonmaker, J. P. and Ladeira, M. M. 2014. Expression of genes involved in lipid metabolism in the muscle of beef cattle fed soybean or rumen-protected fat, with or without monensin supplementation. Journal of Animal Science 92:5426-5436. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.2527/jas.2014-7855">https://doi.org/10.2527/jas.2014-7855</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Oliveira</surname>
							<given-names>D. M.</given-names>
						</name>
						<name>
							<surname>Chalfun-Junior</surname>
							<given-names>A.</given-names>
						</name>
						<name>
							<surname>Chizzotti</surname>
							<given-names>M. L.</given-names>
						</name>
						<name>
							<surname>Barreto</surname>
							<given-names>H. G.</given-names>
						</name>
						<name>
							<surname>Coelho</surname>
							<given-names>T. C.</given-names>
						</name>
						<name>
							<surname>Paiva</surname>
							<given-names>L. V.</given-names>
						</name>
						<name>
							<surname>Coelho</surname>
							<given-names>C. P.</given-names>
						</name>
						<name>
							<surname>Teixeira</surname>
							<given-names>P. D.</given-names>
						</name>
						<name>
							<surname>Schoonmaker</surname>
							<given-names>J. P.</given-names>
						</name>
						<name>
							<surname>Ladeira</surname>
							<given-names>M. M.</given-names>
						</name>
					</person-group>
					<year>2014</year>
					<article-title>Expression of genes involved in lipid metabolism in the muscle of beef cattle fed soybean or rumen-protected fat, with or without monensin supplementation</article-title>
					<source>Journal of Animal Science</source>
					<volume>92</volume>
					<fpage>5426</fpage>
					<lpage>5436</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.2527/jas.2014-7855">https://doi.org/10.2527/jas.2014-7855</ext-link>
					</comment>
				</element-citation>
			</ref>
			<ref id="B28">
				<mixed-citation>Pérez, R.; Tupac-Yupanqui, I. and Dunner, S. 2008. Evaluation of suitable reference genes for gene expression studies in bovine muscular tissue. BMC Molecular Biology 9:79. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1186/1471-2199-9-79">https://doi.org/10.1186/1471-2199-9-79</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Pérez</surname>
							<given-names>R.</given-names>
						</name>
						<name>
							<surname>Tupac-Yupanqui</surname>
							<given-names>I.</given-names>
						</name>
						<name>
							<surname>Dunner</surname>
							<given-names>S.</given-names>
						</name>
					</person-group>
					<year>2008</year>
					<article-title>Evaluation of suitable reference genes for gene expression studies in bovine muscular tissue</article-title>
					<source>BMC Molecular Biology</source>
					<volume>9</volume>
					<size units="pages">79</size>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1186/1471-2199-9-79">https://doi.org/10.1186/1471-2199-9-79</ext-link>
					</comment>
				</element-citation>
			</ref>
			<ref id="B29">
				<mixed-citation>Pfaffl, M. W. 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Research 29:e45. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1093/nar/29.9.e45">https://doi.org/10.1093/nar/29.9.e45</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Pfaffl</surname>
							<given-names>M. W.</given-names>
						</name>
					</person-group>
					<year>2001</year>
					<article-title>A new mathematical model for relative quantification in real-time RT-PCR</article-title>
					<source>Nucleic Acids Research</source>
					<volume>29</volume>
					<elocation-id>e45</elocation-id>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1093/nar/29.9.e45">https://doi.org/10.1093/nar/29.9.e45</ext-link>
					</comment>
				</element-citation>
			</ref>
			<ref id="B30">
				<mixed-citation>Robledo, D.; Hernández-Urcera, J.; Cal, R. M.; Pardo, B. G.; Sánchez, L.; Martínez, P. and Viñas, A. 2014. Analysis of qPCR reference gene stability determination methods and a practical approach for efficiency calculation on a turbot (Scophthalmus maximus) gonad dataset. BMC Genomics 15:648. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1186/1471-2164-15-648">https://doi.org/10.1186/1471-2164-15-648</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Robledo</surname>
							<given-names>D.</given-names>
						</name>
						<name>
							<surname>Hernández-Urcera</surname>
							<given-names>J.</given-names>
						</name>
						<name>
							<surname>Cal</surname>
							<given-names>R. M.</given-names>
						</name>
						<name>
							<surname>Pardo</surname>
							<given-names>B. G.</given-names>
						</name>
						<name>
							<surname>Sánchez</surname>
							<given-names>L.</given-names>
						</name>
						<name>
							<surname>Martínez</surname>
							<given-names>P.</given-names>
						</name>
						<name>
							<surname>Viñas</surname>
							<given-names>A.</given-names>
						</name>
					</person-group>
					<year>2014</year>
					<article-title>Analysis of qPCR reference gene stability determination methods and a practical approach for efficiency calculation on a turbot (Scophthalmus maximus) gonad dataset</article-title>
					<source>BMC Genomics</source>
					<volume>15</volume>
					<size units="pages">648</size>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1186/1471-2164-15-648">https://doi.org/10.1186/1471-2164-15-648</ext-link>
					</comment>
				</element-citation>
			</ref>
			<ref id="B31">
				<mixed-citation>Saremi, B.; Sauerwein, H.; Dänicke, S. and Mielenz, M. 2012. Technical note: Identification of reference genes for gene expression studies in different bovine tissues focusing on different fat depots. Journal of Dairy Science 95:3131-3138. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3168/jds.2011-4803">https://doi.org/10.3168/jds.2011-4803</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Saremi</surname>
							<given-names>B.</given-names>
						</name>
						<name>
							<surname>Sauerwein</surname>
							<given-names>H.</given-names>
						</name>
						<name>
							<surname>Dänicke</surname>
							<given-names>S.</given-names>
						</name>
						<name>
							<surname>Mielenz</surname>
							<given-names>M.</given-names>
						</name>
					</person-group>
					<year>2012</year>
					<article-title>Technical note: Identification of reference genes for gene expression studies in different bovine tissues focusing on different fat depots</article-title>
					<source>Journal of Dairy Science</source>
					<volume>95</volume>
					<fpage>3131</fpage>
					<lpage>3138</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3168/jds.2011-4803">https://doi.org/10.3168/jds.2011-4803</ext-link>
					</comment>
				</element-citation>
			</ref>
			<ref id="B32">
				<mixed-citation>Schulz, H. 1996. Chapter 3 - Oxidation of fatty acids. p.75-99. In: New comprehensive biochemistry. Vance, D. E. and Vance, J. E., eds. Elsevier. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1016/S0167-7306(08)60510-4">https://doi.org/10.1016/S0167-7306(08)60510-4</ext-link>
				</mixed-citation>
				<element-citation publication-type="book">
					<person-group person-group-type="author">
						<name>
							<surname>Schulz</surname>
							<given-names>H</given-names>
						</name>
					</person-group>
					<year>1996</year>
					<chapter-title>Chapter 3 - Oxidation of fatty acids</chapter-title>
					<fpage>75</fpage>
					<lpage>99</lpage>
					<source>New comprehensive biochemistry</source>
					<person-group person-group-type="editor">
						<name>
							<surname>Vance</surname>
							<given-names>D. E.</given-names>
						</name>
						<name>
							<surname>Vance</surname>
							<given-names>J. E.</given-names>
						</name>
						<role>eds</role>
					</person-group>
					<publisher-name>Elsevier</publisher-name>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1016/S0167-7306(08)60510-4">https://doi.org/10.1016/S0167-7306(08)60510-4</ext-link>
					</comment>
				</element-citation>
			</ref>
			<ref id="B33">
				<mixed-citation>Teixeira, P. D.; Oliveira, D. M.; Chizzotti, M. L.; Chalfun-Junior, A.; Coelho, T. C.; Gionbelli, M. P.; Paiva, L. V.; Carvalho, J. R. R. and Ladeira, M. M. 2017. Subspecies and diet affect the expression of genes involved in lipid metabolism and chemical composition of muscle in beef cattle. Meat Science 133:110-118. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1016/j.meatsci.2017.06.009">https://doi.org/10.1016/j.meatsci.2017.06.009</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Teixeira</surname>
							<given-names>P. D.</given-names>
						</name>
						<name>
							<surname>Oliveira</surname>
							<given-names>D. M.</given-names>
						</name>
						<name>
							<surname>Chizzotti</surname>
							<given-names>M. L.</given-names>
						</name>
						<name>
							<surname>Chalfun-Junior</surname>
							<given-names>A.</given-names>
						</name>
						<name>
							<surname>Coelho</surname>
							<given-names>T. C.</given-names>
						</name>
						<name>
							<surname>Gionbelli</surname>
							<given-names>M. P.</given-names>
						</name>
						<name>
							<surname>Paiva</surname>
							<given-names>L. V.</given-names>
						</name>
						<name>
							<surname>Carvalho</surname>
							<given-names>J. R. R.</given-names>
						</name>
						<name>
							<surname>Ladeira</surname>
							<given-names>M. M.</given-names>
						</name>
					</person-group>
					<year>2017</year>
					<article-title>Subspecies and diet affect the expression of genes involved in lipid metabolism and chemical composition of muscle in beef cattle</article-title>
					<source>Meat Science</source>
					<volume>133</volume>
					<fpage>110</fpage>
					<lpage>118</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1016/j.meatsci.2017.06.009">https://doi.org/10.1016/j.meatsci.2017.06.009</ext-link>
					</comment>
				</element-citation>
			</ref>
			<ref id="B34">
				<mixed-citation>Vandekerckhove, J. and Weber, K. 1979. The complete amino acid sequence of actins from bovine aorta, bovine heart, bovine fast skeletal muscle, and rabbit, slow skeletal muscle: a protein-chemical analysis of muscle actin differentiation. Differentiation 14:123-133. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1111/j.1432-0436.1979.tb01021.x">https://doi.org/10.1111/j.1432-0436.1979.tb01021.x</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Vandekerckhove</surname>
							<given-names>J.</given-names>
						</name>
						<name>
							<surname>Weber</surname>
							<given-names>K.</given-names>
						</name>
					</person-group>
					<year>1979</year>
					<article-title>The complete amino acid sequence of actins from bovine aorta, bovine heart, bovine fast skeletal muscle, and rabbit, slow skeletal muscle: a protein-chemical analysis of muscle actin differentiation</article-title>
					<source>Differentiation</source>
					<volume>14</volume>
					<fpage>123</fpage>
					<lpage>133</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1111/j.1432-0436.1979.tb01021.x">https://doi.org/10.1111/j.1432-0436.1979.tb01021.x</ext-link>
					</comment>
				</element-citation>
			</ref>
			<ref id="B35">
				<mixed-citation>Vandesompele, J.; De Preter, K.; Pattyn, F.; Poppe, B.; Van Roy, N.; De Paepe, A. and Speleman, F. 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biology 3. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1186/gb-2002-3-7-research0034">https://doi.org/10.1186/gb-2002-3-7-research0034</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Vandesompele</surname>
							<given-names>J.</given-names>
						</name>
						<name>
							<surname>De Preter</surname>
							<given-names>K.</given-names>
						</name>
						<name>
							<surname>Pattyn</surname>
							<given-names>F.</given-names>
						</name>
						<name>
							<surname>Poppe</surname>
							<given-names>B.</given-names>
						</name>
						<name>
							<surname>Van Roy</surname>
							<given-names>N.</given-names>
						</name>
						<name>
							<surname>De Paepe</surname>
							<given-names>A.</given-names>
						</name>
						<name>
							<surname>Speleman</surname>
							<given-names>F.</given-names>
						</name>
					</person-group>
					<year>2002</year>
					<article-title>Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes</article-title>
					<source>Genome Biology 3</source>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1186/gb-2002-3-7-research0034">https://doi.org/10.1186/gb-2002-3-7-research0034</ext-link>
					</comment>
				</element-citation>
			</ref>
			<ref id="B36">
				<mixed-citation>Varshney, N.; Mohanty, A. K.; Kumar, S.; Kaushik, J. K.; Dang, A. K.; Mukesh, M.; Mishra, B. P.; Kataria, R.; Kimothi, S. P.; Mukhopadhyay, T. K.; Malakar, D.; Prakash, B. S.; Grover, S. and Batish, V. K. 2012. Selection of suitable reference genes for quantitative gene expression studies in milk somatic cells of lactating cows (Bos indicus). Journal of Dairy Science 95:2935-2945. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3168/jds.2011-4442">https://doi.org/10.3168/jds.2011-4442</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Varshney</surname>
							<given-names>N.</given-names>
						</name>
						<name>
							<surname>Mohanty</surname>
							<given-names>A. K.</given-names>
						</name>
						<name>
							<surname>Kumar</surname>
							<given-names>S.</given-names>
						</name>
						<name>
							<surname>Kaushik</surname>
							<given-names>J. K.</given-names>
						</name>
						<name>
							<surname>Dang</surname>
							<given-names>A. K.</given-names>
						</name>
						<name>
							<surname>Mukesh</surname>
							<given-names>M.</given-names>
						</name>
						<name>
							<surname>Mishra</surname>
							<given-names>B. P.</given-names>
						</name>
						<name>
							<surname>Kataria</surname>
							<given-names>R.</given-names>
						</name>
						<name>
							<surname>Kimothi</surname>
							<given-names>S. P.</given-names>
						</name>
						<name>
							<surname>Mukhopadhyay</surname>
							<given-names>T. K.</given-names>
						</name>
						<name>
							<surname>Malakar</surname>
							<given-names>D.</given-names>
						</name>
						<name>
							<surname>Prakash</surname>
							<given-names>B. S.</given-names>
						</name>
						<name>
							<surname>Grover</surname>
							<given-names>S.</given-names>
						</name>
						<name>
							<surname>Batish</surname>
							<given-names>V. K.</given-names>
						</name>
					</person-group>
					<year>2012</year>
					<article-title>Selection of suitable reference genes for quantitative gene expression studies in milk somatic cells of lactating cows (Bos indicus)</article-title>
					<source>Journal of Dairy Science</source>
					<volume>95</volume>
					<fpage>2935</fpage>
					<lpage>2945</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3168/jds.2011-4442">https://doi.org/10.3168/jds.2011-4442</ext-link>
					</comment>
				</element-citation>
			</ref>
			<ref id="B37">
				<mixed-citation>Wan, H.; Zhao, Z.; Qian, C.; Sui, Y.; Malik, A. A. and Chen, J. 2010. Selection of appropriate reference genes for gene expression studies by quantitative real-time polymerase chain reaction in cucumber. Analytical biochemistry 399:257-261. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1016/j.ab.2009.12.008">https://doi.org/10.1016/j.ab.2009.12.008</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Wan</surname>
							<given-names>H.</given-names>
						</name>
						<name>
							<surname>Zhao</surname>
							<given-names>Z.</given-names>
						</name>
						<name>
							<surname>Qian</surname>
							<given-names>C.</given-names>
						</name>
						<name>
							<surname>Sui</surname>
							<given-names>Y.</given-names>
						</name>
						<name>
							<surname>Malik</surname>
							<given-names>A. A.</given-names>
						</name>
						<name>
							<surname>Chen</surname>
							<given-names>J.</given-names>
						</name>
					</person-group>
					<year>2010</year>
					<article-title>Selection of appropriate reference genes for gene expression studies by quantitative real-time polymerase chain reaction in cucumber</article-title>
					<source>Analytical biochemistry</source>
					<volume>399</volume>
					<fpage>257</fpage>
					<lpage>261</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1016/j.ab.2009.12.008">https://doi.org/10.1016/j.ab.2009.12.008</ext-link>
					</comment>
				</element-citation>
			</ref>
		</ref-list>
	</back>
</article>