In addition to traditional methods of animal genetic improvement, marker-assisted selection promises to help improve traits associated with beef and carcass quality of cattle. Several studies have been performed in beef cattle to evaluate the effect of known polymorphisms, as well as to prospect new markers in candidate genes associated with traits of economic interest.

It is in this sense that the calpain/calpastatin enzyme complex has been drawing attention to studies of molecular markers that could be used for the genetic improvement of beef cattle. Calpain is endogenous calcium and cysteine-dependent protease involved in the breakdown of skeletal muscle proteins, which is inhibited by the enzyme calpastatin (Koohmaraie, 1996). This enzyme complex is activated after animal slaughter and is directly involved with meat tenderization during the maturation process. In several studies, it was observed that the greater proportion of Zebu blood in the herd, the less tender is the meat, because of post-mortem increase in the activity of calpastatin (Johnson et al., 1990; Sherbeck et al., 1995; Rubensam et al., 1998; Ferguson et al., 2000; Restle et al., 2003).

Calpastatin enzyme is encoded by the CAST gene located on chromosome 7 (Bishop et al., 1993), while calpain is encoded by the CAPN1 gene found on chromosome 29 (Smith et al., 2000). The nucleotide sequences of these genes are deposited in GenBank (http://www.ncbi.nlm.nih.gov/) under accession numbers AF159246 and AF248054, respectively.

Barendse (2002) identified a single nucleotide polymorphism (SNP) characterized by the transition of an adenine to a guanine in the 3’UTR of the CAST gene (AF159246:g.2959A>G). The PCR-RFLP (Polymerase Chain Reaction-Restriction Fragment Length Polymorphism) methodology described by Curi et al. (2008) to genotype this SNP and amplifies a 269 base pair (bp) fragment that, once digested by the restriction enzyme DdeI, yields either one 269 bp fragment in the case of the G allele or two fragments in the case of the A allele (137 and 132 bp). However, since only one restriction site for DdeI is found on this fragment, in cases of suboptimal enzyme performance, an undigested 269 bp fragment may be erroneously interpreted as an individual that presents homozygous genotype GG. In light of this, new PCR primers were developed in this work to amplify a larger region of CAST gene (486 bp), which incorporated an additional DdeI restriction site, thus avoiding technical problems.

Several SNP have been identified in the CAPN1 gene, including CAPN316, CAPN530, CAPN4751, CAPN4753, and CAPN5331 (Page et al., 2002, 2004; White et al., 2005; Casas et al., 2005, 2006). According to White et al. (2005), CAPN4751 is a silent mutation in intron 18 (AF248054.2:g.6545C>T) involving the cytosine to thymine base substitution (C/T) and was the first marker in this gene to be significantly associated with meat tenderness in both Bos taurus taurus and Bos taurus indicus. This marker has been genotyped by multiplex MassArray (White et al., 2005), and the amplification refractory mutation system-polymerase chain reaction (ARMS-PCR) was suggested by Rincón and Medrano (2006).

To genotype this polymorphism with the same technique as that applied for the CAST, PCR was carried out using only the pair of “outer” primers described by Rincón and Medrano (2006). Additionally, the PCR product was digested by DdeI restriction endonuclease.

This study aimed to genotype the SNP AF159246:g.2959A>G, located in the CAST gene, and AF248054.2:g.6545C>T, located in the CAPN1 gene, in beef cattle, by PCR-RFLP methodology using the restriction enzyme DdeI and describe for the first time the use of the new primers for the first SNP and the incorporation of the DdeI restriction enzyme for the second SNP.

Blood and semen samples were obtained from Bonsmara, Caracu, and Senepol (adapted taurines), Nelore (zebuine), and Angus (non-adapted taurine) bulls. Samples were obtained from insemination centers, beef cattle breed associations, and breeders. Bulls were selected to have the least possible degree of parentage, determined by their genealogy. Relationship and inbreeding coefficients were determined by scripts developed in MATLAB software (Little and Moler, 2002).

Genomic DNA was extracted from leukocytes and semen using an adapted protocol made by Regitano and Coutinho (2001), who used the protocols described by Olerup and Zetterquist (1992) for leukocytes and Zadworny and Kuhnlein (1990) for semen. Genomic DNA was quantified on a NanoDrop (Thermo Scientific) spectrophotometer and integrity was verified by 0.8% agarose gel electrophoresis. DNA samples were diluted in TE (10 mM Tris HCl pH 7.6; 1 mM EDTA) and stored in 40 ng/µL aliquots.

A total of 126 bulls were genotyped for the SNP AF159246:g.2959A>G in the CAST gene (CAST/DdeI): Bonsmara (n = 25), Caracu (n = 25), Senepol (n = 25), Angus (n = 25), and Nelore (n = 26). For the SNP AF248054.2:g.6545C>T in the CAPN1 gene (CAPN4751/DdeI) 122 bulls were genotyped: Bonsmara (n = 22), Caracu (n = 26), Senepol (n = 24), Angus (n = 24) and Nelore (n = 26).

The CAST/DdeI polymorphism involved the amplification of a 486 bp fragment in the 3´UTR using forward 5’TGAATTTGTCTGGTTCACCTGT3’ and reverse primer 5’GACAAGGTGCGGAAGTCCTA3’, described in this work for the first time, and was followed by DdeI restriction endonuclease (Curi et al., 2008). The DdeI endonuclease recognizes the 5’C´TNAG 3’ site restriction (Invitrogen, USA). For CAPN4751/DdeI, a 334 pb fragment was amplified from the pair of “outer” primers used by White et al. (2005), of which were forward 5’ CCTGGAGTCCTGCCGCAGCATGGTCAAC 3’ and reverse 5’AAGCTGCAGGAGCTGCCCAAAGCCAGGC3’, followed by the digestion using the same restriction endonuclease (DdeI).

The amplification reactions were performed in final volume of 25 μL containing 40 ng genomic DNA, 1 X PCR buffer, 1.5 mM MgCl₂, 0.2 mM dNTP, 1U Taq DNA polymerase, and 0.2 μM of each CAST/DdeI primer or 0.16 μM of each CAPN4751/DdeI primer. After initial denaturation at 94 °C for 5 min, amplification was performed in 30 cycles at 94 °C for 1 min, 58 °C for either 30 s (CAPN4751/DdeI) or 1 min (CAST/DdeI) and 72 °C for 1 min, followed by a final extension step at 72 °C for 5 min. Eight microliters of PCR products were separated and observed by electrophoresis in a 1% agarose gel.

Aliquots of 7 μL of the amplification products were digested with DdeI restriction endonuclease in a final volume of 10 μL containing 3 μL of digestion mix (1 U DdeI, 50 mM Tris-HCl pH 8.0, 100 mM NaCl, 10 mM MgCl₂) at 37 °C for 4 h. DNA fragments were separated by electrophoresis in a 3% agarose gel stained with SybrGold (1:100,000) and photographed.

Based on the genotypes identified on agarose gels, Hardy-Weinberg equilibrium was assessed within breeds using Chi-square (X²) test, following the current formula:

in which n is number of genotypes, o_i is the observed frequency of i, e_i is the expected frequency of i ( p2+2pq+q2=1), and i is the genotypes of each loci.

Allelic and genotypic frequencies were compared by breed, in a pairwise way, using a modified Chi-square (X²) test, in which o_i is the observed frequency for breed “A” and e_i is the observed frequency for breed “B”.

The accuracy of genotyping by PCR-RFLP technique for the SNP AF159246:g.2959A>G (CAST) and AF248054.2:g.6545C>T (CAPN1), using DdeI restriction enzyme, was confirmed through the direct sequencing of PCR products of six individuals for each polymorphism.

The nucleotide sequences of CAST and CAPN1 genes are deposited in GenBank (http://www.ncbi.nlm.nih.gov/) under accession numbers AF159246 and AF248054.2, respectively.

The digestion of CAST gene resulted in four fragments for the A allele (195, 191, 68, and 32 bp) and three fragments for the G allele (386, 68, and 32 bp). Digestion of heterozygous samples resulted in all five fragments from the combination of both alleles (Figure 1). For the CAPN1 gene, digestion resulted in three fragments for the T allele (159, 63, and 54 bp) and three fragments for the C allele (213, 63, and 54 bp). Heterozygous samples also yielded all four possible fragments from the combination of both alleles (Figure 2).

Fragments present in all genotypes, such as the 68 and 32 bp fragments for the CAST gene and the 63 and 54 bp fragments for the CAPN1 gene, were considered controls to warrant that endonuclease digestion took place for each sample, thereby guaranteeing accuracy.

The Bonsmara breed was the only one to present one allelic variant for the AF159246: g.2959A> G (CAST/DdeI) SNP, having only observed individuals with the AA genotype. Allelic frequencies of this polymorphism ranged from 60.0% (Nelore) to 100.0% (Bonsmara) for the A allele and 6.0% (Angus) to 40.0% (Nelore) for the G allele (Table 1).

Results of the Chi-square test for the CAST/DdeI polymorphism showed that Angus, Caracu, Nelore, and Senepol breeds are in Hardy-Weinberg equilibrium (P>0.05), which indicates that the genotypic frequencies remain constant over generations and that the calpastatin gene is not undergoing selective pressures.

However, for the Bonsmara breed, the frequency of heterozygous (AG) and homozygous (GG) animals was less than expected, indicating that the population is not under Hardy-Weinberg equilibrium (P<0.05). Although the necessary caution was taken in the selection of animals, this may be due to the fact that the animals present a higher degree of relationship than expected, which leads to an overestimation of the sample size.

Significant differences were observed between genotypic and allelic frequencies between breeds for the CAST/DdeI SNP (Table 1). Two-by-two comparison for genotypic frequency yielded significant differences (P<0.05) between Bonsmara/Caracu, Bonsmara/Senepol, Bonsmara/Nelore, Caracu/Angus, Senepol/Angus, and Angus/Nelore but not between Bonsmara/Angus, Caracu/Senepol, Caracu/Nelore, and Senepol/Nelore (Table 2).

The allelic and genotypic frequencies for the SNP AF248054.2:g.6545C>T (CAPN4751/DdeI) were compared by the Chi-square test and both showed a significant difference (P<0.05) between breeds (Table 1). The Caracu breed presented the highest frequency (73.1%) for the C allele, while the Nelore breed presented the highest frequency (88.5%) for the T allele, both compared to the other breeds.

In the two-by-two comparison, for genotypic frequency, the Caracu/Angus, Caracu/Senepol, and Senepol/Angus breeds did not differ significantly between them (P>0.05), while the Angus/Nelore, Senepol/Nelore, Caracu/Nelore, Bonsmara/Nelore, Bonsmara/Angus, Bonsmara/Senepol, and Bonsmara/Caracu comparisons yielded significant differences (P<0.05) for this marker (Table 3).

For CAST/DdeI polymorphism, the Bonsmara breed presented the highest frequency of the A allele (100.0%), followed by Angus (94.0%), Senepol (76.0%), Caracu (68.0%), and Nelore (60.0%) (Table 1). This result is consistent with the literature, which has reported Nelore as having the lowest frequency of the A allele, as shown by Curi et al. (2009). Working with 300 animals, the authors found the lower frequencies for Nelore (55.7%) and Canchim (69.5%) than for Braunvieh three-cross way (73.3%), Rubia Galega × Nelore (82.9%), Brangus three-cross way (84.2%), and Angus × Nelore (89.5%).

Studying a population of taurine animals, Morris et al. (2006) found frequencies between 84.0 and 99.5% for the A allele. Casas et al. (2006) also observed a higher frequency of the A allele in taurine animals (80.0%) and crossed animals B. taurus taurus × B. taurus indicus (83.0%) than in zebuine animals (72.0%). According to Rubensam et al. (1998), animals of the B. taurus indicus breeds produce less tender meat than animals of the B. taurus taurus breeds and their crossings B. taurus taurus × B. taurus indicus due to increasing calpastatin enzyme activity when the proportion of zebu blood increase in the animals crossed.

The differences observed between zebuine (Nelore) and taurine (Angus, Bonsmara, and Senepol) breeds are in accordance with literature, suggesting that, as long as association to the traits is confirmed, the CAST/DdeI marker may be used in the selection of animals with better beef quality due to the medium-to-high frequency of the favorable allele in the population.

White et al. (2005) observed an association of the C allele for the CAPN4751 marker with lower values for shear force in pure taurine, taurine crosses, and zebuine × taurine crosses, which suggest that this allele favors meat tenderness. In the present study, both allelic variants (T and C) were observed in the five breeds analyzed (Table 1). The C allele was observed less frequently in Nelore, which was in accordance with the literature that states that zebuine beef presents a higher concentration of calpastatin.

Soria et al. (2010) also observed a lower frequency of the C allele in Brangus and Brahman animals, when compared with Angus breed. The frequency for this allele was 68.0, 55.0, and 5.0% for Angus, Brangus, and Brahman, respectively, and the authors did not detect the CC genotype in Brahman animals.

White et al. (2005) evaluated genotypic and allelic frequencies of the CAPN4751 marker in three populations. The first population was comprised of B. taurus taurus descendents, the second consisted of B. taurus taurus germplasm with influence from B. taurus indicus, and the third was comprised solely by B. taurus indicus cattle (pure breed Brahman). The authors observed that the CC genotype was missing in the B. taurus indicus population and found that the homozygotes for the C allele presented lower mean shear force than homozygotes for the T allele.

Casas et al. (2006) evaluated the same marker in the same three populations and found significant association for beef tenderness scores in two of the three populations: one comprised of B. taurus taurus descendents and the other of B. taurus taurus germplasm with influence from B. taurus indicus. Authors also showed that bearers of the CC and CT genotypes presented more tender beef (P<0.05) compared with animals with the TT genotype.

Calpain-calpastatin system studies may help explain differences in bovine beef tenderness, since markers in these genes are highly associated with this trait in both taurine and zebuine breeds, which could help the selection of animals that present superior genetics to produce better-quality meat.

The PCR-RFLP methodology was successfully used to detect polymorphisms in both CAST and CAPN1 genes using long primers and generating fragments that can be used as quality control for the digestion reaction. These methods are robust, relatively inexpensive, and can be easily carried out in any basic molecular biology laboratory. The results obtained by these methodologies may contribute to the selection of animals with superior genotypes and, thus, for the production of better-quality beef.