<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.1 20151215//EN" "https://jats.nlm.nih.gov/publishing/1.1/JATS-journalpublishing1.dtd">
<article article-type="research-article" dtd-version="1.1" specific-use="sps-1.8" xml:lang="en" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink">
	<front>
		<journal-meta>
			<journal-id journal-id-type="publisher-id">rbz</journal-id>
			<journal-title-group>
				<journal-title>Revista Brasileira de Zootecnia</journal-title>
				<abbrev-journal-title abbrev-type="publisher">R. Bras. Zootec.</abbrev-journal-title>
			</journal-title-group>
			<issn pub-type="ppub">1516-3598</issn>
			<issn pub-type="epub">1806-9290</issn>
			<publisher>
				<publisher-name>Sociedade Brasileira de Zootecnia</publisher-name>
			</publisher>
		</journal-meta>
		<article-meta>
			<article-id pub-id-type="other">00506</article-id>
			<article-id pub-id-type="doi">10.1590/rbz4820170298</article-id>
			<article-categories>
				<subj-group subj-group-type="heading">
					<subject>Non-Ruminants</subject>
				</subj-group>
			</article-categories>
			<title-group>
				<article-title>Optimization of solid-state fermentation conditions of <italic>Bacillus licheniformis</italic> and its effects on <italic>Clostridium perfringens</italic>-induced necrotic enteritis in broilers</article-title>
			</title-group>
			<contrib-group>
				<contrib contrib-type="author">
					<contrib-id contrib-id-type="orcid">0000-0003-4765-2156</contrib-id>
					<name>
						<surname>Lin</surname>
						<given-names>En-Ru</given-names>
					</name>
					<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
				</contrib>
				<contrib contrib-type="author">
					<contrib-id contrib-id-type="orcid">0000-0001-6009-6006</contrib-id>
					<name>
						<surname>Cheng</surname>
						<given-names>Yeong-Hsiang</given-names>
					</name>
					<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
				</contrib>
				<contrib contrib-type="author">
					<contrib-id contrib-id-type="orcid">0000-0002-4401-5146</contrib-id>
					<name>
						<surname>Hsiao</surname>
						<given-names>Felix Shih-Hsiang</given-names>
					</name>
					<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
				</contrib>
				<contrib contrib-type="author">
					<contrib-id contrib-id-type="orcid">0000-0002-0799-2407</contrib-id>
					<name>
						<surname>Proskura</surname>
						<given-names>Witold S.</given-names>
					</name>
					<xref ref-type="aff" rid="aff3"><sup>3</sup></xref>
				</contrib>
				<contrib contrib-type="author">
					<contrib-id contrib-id-type="orcid">0000-0002-1116-6933</contrib-id>
					<name>
						<surname>Dybus</surname>
						<given-names>Andrzej</given-names>
					</name>
					<xref ref-type="aff" rid="aff3"><sup>3</sup></xref>
				</contrib>
				<contrib contrib-type="author">
					<contrib-id contrib-id-type="orcid">0000-0001-9629-8478</contrib-id>
					<name>
						<surname>Yu</surname>
						<given-names>Yu-Hsiang</given-names>
					</name>
					<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
					<xref ref-type="corresp" rid="c1">*</xref>
				</contrib>
				<aff id="aff1">
					<label>1</label>
					<institution content-type="orgname">National Ilan University</institution>
					<institution content-type="orgdiv1">Department of Biotechnology and Animal Science</institution>
					<addr-line>
						<named-content content-type="city">Yilan</named-content>
					</addr-line>
					<country country="TW">Taiwan</country>
					<institution content-type="original">National Ilan University, Department of Biotechnology and Animal Science, Yilan, Taiwan.</institution>
				</aff>
				<aff id="aff2">
					<label>2</label>
					<institution content-type="orgname">Tunghai University</institution>
					<institution content-type="orgdiv1">Department of Animal Science and Biotechnology</institution>
					<addr-line>
						<named-content content-type="city">Taichung</named-content>
					</addr-line>
					<country country="TW">Taiwan</country>
					<institution content-type="original">Tunghai University, Department of Animal Science and Biotechnology, Taichung, Taiwan.</institution>
				</aff>
				<aff id="aff3">
					<label>3</label>
					<institution content-type="orgname">West Pomeranian University of Technology</institution>
					<institution content-type="orgdiv1">Laboratory of Molecular Cytogenetics</institution>
					<addr-line>
						<named-content content-type="city">Szczecin</named-content>
					</addr-line>
					<country country="PL">Poland</country>
					<institution content-type="original">West Pomeranian University of Technology, Laboratory of Molecular Cytogenetics, Szczecin, Poland.</institution>
				</aff>
			</contrib-group>
			<author-notes>
				<corresp id="c1">
					<label>*</label><bold>Corresponding author:</bold><email>yuyh@niu.edu.tw</email>
				</corresp>
			</author-notes>
			<pub-date pub-type="epub">
				<day>29</day>
				<month>03</month>
				<year>2019</year>
			</pub-date>
			<volume>48</volume>
			<elocation-id>e20170298</elocation-id>
			<history>
				<date date-type="received">
					<day>20</day>
					<month>11</month>
					<year>2017</year>
				</date>
				<date date-type="accepted">
					<day>12</day>
					<month>01</month>
					<year>2018</year>
				</date>
			</history>
			<permissions>
				<license license-type="open-access" xlink:href="https://creativecommons.org/licenses/by/4.0/" xml:lang="en">
					<license-p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
				</license>
			</permissions>
			<abstract>
				<title>ABSTRACT</title>
				<p>In the present study, we examined the growth parameters of <italic>Bacillus licheniformis</italic> in solid-state fermentation (SSF) and evaluated the effects of <italic>Bacillus licheniformis</italic>-fermented products on <italic>Clostridium perfringens</italic>-challenged broilers. During four and six days of SSF, the highest viable biomass was observed at 5% glucose, 10% soybean meal, 3% yeast, and 50% initial moisture content. The <italic>Bacillus licheniformis</italic> SSF products were heat- and acid-resistant. Furthermore, the fermented products were able to inhibit the growth of <italic>Clostridium perfringens</italic> and <italic>Staphylococcus aureus in vitro</italic>. In feeding experiments, in a similar manner to the antibiotic treatment group, dietary supplementation of <italic>Bacillus licheniformis</italic>-fermented products significantly improved intestinal morphology and necrotic lesions under <italic>Clostridium perfringens</italic> challenge, accompanied by increased <italic>IFN-γ</italic> mRNA expression in the spleen and bursa of Fabricius. These results together suggest that <italic>Bacillus licheniformis</italic>-fermented products have potential for development as feed additives and use as possible substitutes for antibiotics to treat <italic>Clostridium perfringens</italic> in the poultry industry.</p>
			</abstract>
			<kwd-group xml:lang="en">
				<title>Keywords:</title>
				<kwd>broiler</kwd>
				<kwd>disease</kwd>
				<kwd>fermentation</kwd>
				<kwd>probiotics</kwd>
			</kwd-group>
			<funding-group>
				<award-group>
					<funding-source>Agricultural Technology Research Institute</funding-source>
					<award-id>10610068</award-id>
				</award-group>
				<award-group>
					<funding-source>Chung Cheng Agriculture Science and Social Welfare Foundation</funding-source>
					<award-id>106-3</award-id>
				</award-group>
				<award-group>
					<funding-source>Ministry of Science and Technology (MOST)</funding-source>
					<award-id>MOST 107-2321-B-197-002</award-id>
				</award-group>
			</funding-group>
			<counts>
				<fig-count count="6"/>
				<table-count count="5"/>
				<equation-count count="0"/>
				<ref-count count="34"/>
			</counts>
		</article-meta>
	</front>
	<body>
		<sec sec-type="intro">
			<title>Introduction</title>
			<p>Necrotic enteritis (NE) is an extremely common and important avian enteric disease caused mainly by <italic>Clostridium perfringens</italic> (<xref ref-type="bibr" rid="B31">Van Immerseel et al., 2004</xref>; <xref ref-type="bibr" rid="B29">Timbermont et al., 2011</xref>; <xref ref-type="bibr" rid="B1">Abudabos et al., 2018</xref>). It leads to enormous economic losses in the poultry industry worldwide (<xref ref-type="bibr" rid="B30">Van der Sluis, 2000</xref>; <xref ref-type="bibr" rid="B29">Timbermont et al., 2011</xref>). <italic>Clostridium perfringens</italic> is a Gram-positive anaerobic spore-forming bacterium found in the gastrointestinal tract of broilers (<xref ref-type="bibr" rid="B31">Van Immerseel et al., 2004</xref>; <xref ref-type="bibr" rid="B7">Dahiya et al., 2005</xref>). The disease prevalently occurs in broilers aged from two to six weeks and causes sudden death with mortality rates up to 50% (<xref ref-type="bibr" rid="B13">Kaldhusdal and Løvland, 2000</xref>; <xref ref-type="bibr" rid="B21">Lee et al., 2011</xref>).</p>
			<p>Antibiotics have been commonly used worldwide as growth promoters and for prophylactic treatment of <italic>Clostridium perfringens</italic>-induced NE in poultry (<xref ref-type="bibr" rid="B31">Van Immerseel et al., 2004</xref>; <xref ref-type="bibr" rid="B4">Caly et al., 2015</xref>). However, the European Union has banned the use of antibiotics, leading to an increase in NE outbreaks in broilers in European countries (<xref ref-type="bibr" rid="B30">Van der Sluis, 2000</xref>; <xref ref-type="bibr" rid="B31">Van Immerseel et al., 2004</xref>). Therefore, alternative strategies to prevent NE in broilers are needed in the poultry industry. Over the past few years, it has been demonstrated that dietary supplementation of probiotics can inhibit the growth of gastrointestinal pathogens and subsequent diseases by producing antimicrobial substances (<xref ref-type="bibr" rid="B25">Patterson and Burkholder, 2003</xref>; <xref ref-type="bibr" rid="B23">Lutful Kabir, 2009</xref>; <xref ref-type="bibr" rid="B5">Cheng et al., 2018</xref>). Among <italic>Bacillus</italic> species, <italic>Bacillus licheniformis</italic> has been identified in the gastrointestinal tract of broilers with activity against <italic>Clostridium perfringens in vitro</italic> (<xref ref-type="bibr" rid="B3">Barbosa et al., 2005</xref>). Furthermore, it has been reported that dietary supplementation of <italic>Bacillus licheniformis</italic> improves growth performance of broiler chickens (<xref ref-type="bibr" rid="B22">Liu et al., 2012</xref>; <xref ref-type="bibr" rid="B2">Al-Sagan and Abudabos, 2017</xref>). <italic>Clostridium perfringens</italic>-induced NE is alleviated in <italic>Bacillus licheniformis</italic>-fed broiler chickens (<xref ref-type="bibr" rid="B18">Knap et al., 2010</xref>; <xref ref-type="bibr" rid="B34">Zhou et al., 2016</xref>).</p>
			<p>Solid-state fermentation (SSF) has been widely used to scale-up production of value-added products as it has low capital investment and is environment-friendly (<xref ref-type="bibr" rid="B11">Hölker and Lenz, 2005</xref>; <xref ref-type="bibr" rid="B19">Krishna, 2005</xref>; <xref ref-type="bibr" rid="B8">el-Bendary, 2006</xref>). Several fermentation parameters are known to affect the growth of probiotics, and only few studies have investigated these parameters for <italic>Bacillus licheniformis</italic> growth in SSF (<xref ref-type="bibr" rid="B16">Kiers et al., 2000</xref>; <xref ref-type="bibr" rid="B33">Zhao et al., 2008</xref>). The conditions of SSF for <italic>Bacillus licheniformis</italic> growth and the effects of fermented products on broilers under <italic>Clostridium perfringens</italic> challenge have not been widely studied.</p>
			<p>The purpose of this study was to investigate the growth parameters of <italic>Bacillus licheniformis</italic> in SSF and the effects of <italic>Bacillus licheniformis</italic>-fermented products on <italic>Clostridium perfringens</italic>-challenged broilers. The results provide valuable information about the growth of <italic>Bacillus licheniformis</italic> in SSF and its effect on <italic>Clostridium perfringens</italic>-induced NE in broilers.</p>
		</sec>
		<sec sec-type="materials|methods">
			<title>Material and Methods</title>
			<p>Research on animals was conducted according to the institutional committee on animal use (IACUC Approval No. 104-14). All experiments were conducted in Yilan, Taiwan (latitude 24°46'00&quot; N and longitude 121°45'00&quot; E). The experimental period was carried out between July 1 and December 15, 2015.</p>
			<p><italic>Bacillus licheniformis</italic> was purchased from the Food Industry Research and Development Institute (Hsinchu, Taiwan). After thawing, <italic>Bacillus licheniformis</italic> was inoculated into an Erlenmeyer flask containing tryptic soy broth (Sigma-Aldrich, St. Louis, MO, USA) and incubated at 30 °C for 18 h, being shaken at 160 rpm.</p>
			<p>The procured substrates such as wheat bran, soybean meal, yeast, fish meal, brown sugar, and glucose were ground to fine powder. <italic>Bacillus licheniformis</italic> SSF was optimized by investigating the effect of the following treatments on the bacterial count (colony forming unit – cfu) production, using different concentrations of carbon sources (glucose and brown sugar), concentrations of nitrogen sources (soybean meal and yeast), initial moisture contents (40-70%), and SSF period (two, four, and six days with two-day intervals). Potassium dihydrogen phosphate was added to the fermented substrate to increase the biomass yield by SSF. Each substrate or combined substrates were mixed with water to give the required initial moisture contents in a space bag and autoclaved at 121 °C for 30 min. The cooled substrates were inoculated with 4% (v/w) inoculum, mixed carefully under sterile conditions, and incubated at 30 °C in a chamber with free oxygen and relative humidity above 80%. The fermented products were dried at 50 °C for two days and homogenized by mechanical agitation. The fermented powder was then stored at 4 °C prior to analysis.</p>
			<p>The fermented powder was diluted serially in 0.85% NaCl and plated on tryptic soy agar (TSA; Sigma-Aldrich, St. Louis, MO, USA), which was incubated for 18 h at 30 °C. Bacterial growth was counted and expressed as cfu/g. For determination of spores, fermented powder was diluted in 0.85% NaCl and then heated at 80 °C for 10 min before plating on TSA. After incubation at 30 °C for 18 h, colonies formed were counted and expressed as cfu/g. The counts of surviving cells were determined according to <xref ref-type="bibr" rid="B27">Pieniz et al. (2014)</xref>. For heat-resistant analysis, fermented powder was diluted in 0.85% NaCl and incubated at different temperatures (80, 90, and 100 °C) for 5, 10, and 15 min, respectively. Counts of surviving cells were determined by plating on TSA. The survival percentage (%±SD) of strains to heat was calculated as follows: % survival = (viable count after exposure to heat/viable count without exposure to heat) × 100. For acid-resistant analysis, the fermented powder was diluted in 0.85% NaCl and the viability examined at low pH (pH 2.0, 3.0, and 4.0 prepared in 0.85% NaCl containing 0.1% peptone). The suspensions were incubated at 30 °C for 3 h. Counts of surviving cells were determined by plating on TSA. The survival percentage (%±SD) of strains at different pH values was calculated as follows: % survival = (viable count after exposure to acid/viable count without exposure to acid) × 100. For bile salt-resistant analysis, fermented powder was diluted in PBS containing different concentrations of oxgall (0.1, 0.2, and 0.3%) and plated on TSA. The plates were incubated at 30 °C for 18 h. Cell count was compared with that of the control agar plates (without oxgall). The survival percentage (%±SD) of strains at different concentrations of bile salts was calculated as follows: % survival = (viable count after exposure to bile salts/viable count without exposure to bile salts) × 100.</p>
			<p>Antimicrobial activity of <italic>Bacillus licheniformis</italic> SSF products were analyzed using an agar-well diffusion assay. The necrotic enteritis beta toxin-like (NetB)-positive <italic>Clostridium perfringens</italic> (ATCC 13124) and <italic>Staphylococcus aureus</italic> (BCRC10780) were used as indicators of bacterial pathogen for the determination of antimicrobial activity. The fermented powder was diluted in 0.85% NaCl and transferred into a well in Gifu anaerobic medium agar (GAM agar; Sigma-Aldrich, St. Louis, MO, USA) containing <italic>Clostridium perfringens</italic>. The plates were incubated under anaerobic conditions at 37 °C for 24 h and then examined for zones of inhibition. The control discs were impregnated with ampicillin and enramycin. The fermented powder was diluted in 0.85% NaCl and transferred into a well in the lysogeny broth agar (LB agar; Sigma-Aldrich, St. Louis, MO, USA) containing <italic>Staphylococcus aureus</italic>. The plates were incubated at 37 °C for 24 h and then examined for zones of inhibition. The control discs were impregnated with ampicillin.</p>
			<p>A total of 48 one-day-old male broilers (Avian) were purchased from a local commercial hatchery. All the broilers were randomly divided into four groups with three replicates. Each replicate was assigned to a cage (four chicks per cage of 68 × 66 × 33 cm dimension). The four groups (n = 12 per group) were: basal diet (control) plus oral administration of <italic>Clostridium perfringens</italic> (1×10<sup>8</sup> cfu/mL), basal diet plus oral administration of <italic>Clostridium perfringens</italic> (1×10<sup>8</sup> cfu/mL) and 2 g/kg of bacitracin methylene disalicylate (BMD), basal diet plus oral administration of <italic>Clostridium perfringens</italic> (1×10<sup>8</sup> cfu/mL) and 3 g/kg of four-day fermented product (4DF; 1.2×10<sup>6</sup> cfu/g spore count), and basal diet plus oral administration of <italic>Clostridium perfringens</italic> (1×10<sup>8</sup> cfu/mL) and 3 g/kg of six-day fermented product (6DF; 1.2×10<sup>6</sup> cfu/g spore count). The basal diets were formulated based on the National Research Council recommendations (<xref ref-type="bibr" rid="B24">NRC, 1994</xref>) (<xref ref-type="table" rid="t1">Table 1</xref>). Feed and water were offered <italic>ad libitum</italic>. Birds were housed in stainless-steel and temperature-controlled batteries for five weeks. The temperature was set at 32 °C on the first day, gradually reduced to 24 °C by the third week, and then maintained at 24 °C until the end of the experiment. The lighting schedule was 22L:2D throughout the experiment. Birds were orally inoculated with 1 mL (1×10<sup>8</sup> cfu/mL) of an overnight culture of <italic>Clostridium perfringens</italic> on 18, 19, and 20 days of age. The individual body weight, average daily gain, average daily feed intake, and feed conversion ratio (FCR) was recorded every week. Broilers were sacrificed by cervical dislocation at 22 and 35 days of age. The small intestine, spleen, and bursa of Fabricius were excised and analyzed.</p>
			<table-wrap id="t1">
				<label>Table 1</label>
				<caption>
					<title>Nutrient composition of basal diet</title>
				</caption>
				<table frame="hsides" rules="groups">
					<colgroup width="20%">
						<col/>
						<col/>
						<col/>
						<col/>
						<col/>
					</colgroup>
					<thead style="border-top: thin solid; border-bottom: thin solid; border-color: #000000">
						<tr>
							<th align="left" valign="middle">Ingredient (g kg<sup>−1</sup> of dry matter)</th>
							<th align="center" valign="middle">Control</th>
							<th align="center" valign="middle">BMD</th>
							<th align="center" valign="middle">4DF</th>
							<th align="center" valign="middle">6DF</th>
						</tr>
					</thead>
					<tbody style="border-bottom: thin solid; border-color: #000000">
						<tr>
							<td align="left" valign="middle">Corn, yellow</td>
							<td align="center" valign="middle">511.8</td>
							<td align="center" valign="middle">511.8</td>
							<td align="center" valign="middle">511.8</td>
							<td align="center" valign="middle">511.8</td>
						</tr>
						<tr>
							<td align="left" valign="middle">Soybean meal (36.7% CP)</td>
							<td align="center" valign="middle">350</td>
							<td align="center" valign="middle">350</td>
							<td align="center" valign="middle">350</td>
							<td align="center" valign="middle">350</td>
						</tr>
						<tr>
							<td align="left" valign="middle">Fish meal</td>
							<td align="center" valign="middle">100</td>
							<td align="center" valign="middle">100</td>
							<td align="center" valign="middle">100</td>
							<td align="center" valign="middle">100</td>
						</tr>
						<tr>
							<td align="left" valign="middle">CaCO<sub>3</sub> (38%)</td>
							<td align="center" valign="middle">20</td>
							<td align="center" valign="middle">20</td>
							<td align="center" valign="middle">20</td>
							<td align="center" valign="middle">20</td>
						</tr>
						<tr>
							<td align="left" valign="middle">CaHPO<sub>4</sub></td>
							<td align="center" valign="middle">10</td>
							<td align="center" valign="middle">10</td>
							<td align="center" valign="middle">10</td>
							<td align="center" valign="middle">10</td>
						</tr>
						<tr>
							<td align="left" valign="middle">Salt</td>
							<td align="center" valign="middle">4</td>
							<td align="center" valign="middle">4</td>
							<td align="center" valign="middle">4</td>
							<td align="center" valign="middle">4</td>
						</tr>
						<tr>
							<td align="left" valign="middle">Choline (50%)</td>
							<td align="center" valign="middle">0.2</td>
							<td align="center" valign="middle">0.2</td>
							<td align="center" valign="middle">0.2</td>
							<td align="center" valign="middle">0.2</td>
						</tr>
						<tr>
							<td align="left" valign="middle">Vitamin premix<xref ref-type="table-fn" rid="TFN2">1</xref>
							</td>
							<td align="center" valign="middle">1</td>
							<td align="center" valign="middle">1</td>
							<td align="center" valign="middle">1</td>
							<td align="center" valign="middle">1</td>
						</tr>
						<tr>
							<td align="left" valign="middle">Mineral premix<xref ref-type="table-fn" rid="TFN3">2</xref>
							</td>
							<td align="center" valign="middle">1</td>
							<td align="center" valign="middle">1</td>
							<td align="center" valign="middle">1</td>
							<td align="center" valign="middle">1</td>
						</tr>
						<tr>
							<td align="left" valign="middle">Methionine (99.5%)</td>
							<td align="center" valign="middle">2</td>
							<td align="center" valign="middle">2</td>
							<td align="center" valign="middle">2</td>
							<td align="center" valign="middle">2</td>
						</tr>
						<tr>
							<td align="left" valign="middle">Fermented product</td>
							<td align="center" valign="middle"/>
							<td align="center" valign="middle"/>
							<td align="center" valign="middle">3</td>
							<td align="center" valign="middle">3</td>
						</tr>
						<tr>
							<td align="left" valign="middle">Antibiotics (10% BMD)</td>
							<td align="center" valign="middle"/>
							<td align="center" valign="middle">2</td>
							<td align="center" valign="middle"/>
							<td align="center" valign="middle"/>
						</tr>
						<tr>
							<td align="left" valign="middle"/>
							<td align="center" valign="middle"/>
							<td align="center" valign="middle"/>
							<td align="center" valign="middle"/>
							<td align="center" valign="middle"/>
						</tr>
						<tr>
							<td align="left" valign="middle">Calculated composition</td>
							<td align="center" valign="middle"/>
							<td align="center" valign="middle"/>
							<td align="center" valign="middle"/>
							<td align="center" valign="middle"/>
						</tr>
						<tr>
							<td align="left" valign="middle">Crude protein (%)</td>
							<td align="center" valign="middle">23.04</td>
							<td align="center" valign="middle">23.04</td>
							<td align="center" valign="middle">23.04</td>
							<td align="center" valign="middle">23.04</td>
						</tr>
						<tr>
							<td align="left" valign="middle">Metabolizable energy (kcal/kg)</td>
							<td align="center" valign="middle">3350</td>
							<td align="center" valign="middle">3350</td>
							<td align="center" valign="middle">3350</td>
							<td align="center" valign="middle">3350</td>
						</tr>
						<tr>
							<td align="left" valign="middle">Ca (%)</td>
							<td align="center" valign="middle">1.6</td>
							<td align="center" valign="middle">1.6</td>
							<td align="center" valign="middle">1.6</td>
							<td align="center" valign="middle">1.6</td>
						</tr>
						<tr>
							<td align="left" valign="middle">P (%)</td>
							<td align="center" valign="middle">0.8</td>
							<td align="center" valign="middle">0.8</td>
							<td align="center" valign="middle">0.8</td>
							<td align="center" valign="middle">0.8</td>
						</tr>
						<tr>
							<td align="left" valign="middle">Lysine (%)</td>
							<td align="center" valign="middle">1.38</td>
							<td align="center" valign="middle">1.38</td>
							<td align="center" valign="middle">1.38</td>
							<td align="center" valign="middle">1.38</td>
						</tr>
						<tr>
							<td align="left" valign="middle">Methionine + cystine (%)</td>
							<td align="center" valign="middle">1</td>
							<td align="center" valign="middle">1</td>
							<td align="center" valign="middle">1</td>
							<td align="center" valign="middle">1</td>
						</tr>
					</tbody>
				</table>
				<table-wrap-foot>
					<fn id="TFN1">
						<p>CP - crude protein; BMD - bacitracin methylene disalicylate; 4DF - four-day fermented product; 6DF - six-day fermented product.</p>
					</fn>
					<fn id="TFN2">
						<label>1</label>
						<p>Supplied per kg diet: retinol, 6000 IU; cholecalciferol, 900 IU; tocopherol, 30 IU; menadione, 3 mg; riboflavin, 6 mg; pantothenic acid, 18 mg; niacin, 60 mg, cobalamin, 30 μg.</p>
					</fn>
					<fn id="TFN3">
						<label>2</label>
						<p>Supplied per kg diet: Cu, 20 mg; Zn, 100 mg; Fe, 140 mg; Mn, 4 mg; Se, 0.1 mg; I, 0.2 mg.</p>
					</fn>
				</table-wrap-foot>
			</table-wrap>
			<p>Six birds from each group (two birds per replicate) were randomly selected, sacrificed, and examined for degree of <italic>Clostridium perfringens</italic>-induced necrotic lesions. The duodenum, jejunum, and ileum sections of the chick intestine were examined for lesions. Lesion scores were observed and recorded according to previous study (<xref ref-type="bibr" rid="B15">Keyburn et al., 2008</xref>), wherein 0 is normal and 1 to 6 indicate increasing severity of infection: 1 = thin or friable walls; 2 = focal necrosis or ulceration (1-5 foci); 3 = focal necrosis or ulceration (6-15 foci); 4 = focal necrosis or ulceration (16 or more foci); 5 = patches of necrosis of 2-3 cm long; and 6 = diffuse necrosis typical of field cases.</p>
			<p>The small intestine of six birds per group was analyzed at three different locations: 2 cm after the gizzard (duodenum), before Meckel's diverticulum (jejunum), and before the ileo-cecal transition (ileum). These samples were fixed in 10% (w/v) neutral-buffered formalin solution (Sigma, St. Louis, MO, USA) at 4 °C. Tissue was sectioned at 5-μm thickness (three cross-sections from each sample) and stained with hematoxylin and eosin. The villus length and crypt depth of each segment was measured randomly on 30 villi in one bird by using Olympus CKX41 microscope (Olympus Corporation, Tokyo, Japan) with a digital video camera. The images were analyzed using stereological image software, Cast Image System (Version 2.3.1.3, Visiopharm Albertslund, Hørsholm, Denmark).</p>
			<p>Six birds from each group were randomly selected, sacrificed, and examined for gene expression. Total RNA was isolated from the spleen and bursa of Fabricius and homogenized in TRIzol reagent (Invitrogen, Carlsbad, CA, USA) using a homogenizer (SpeedMill PLUS, Analytik Jena, Jena, Germany). Total RNA was then purified and reverse-transcribed by a <italic>Transcriptor Reverse Transcriptase kit</italic> (Roche Applied Science, Indianapolis, IN, USA). Quantitative reverse transcriptase-PCR was performed using <italic>MiniopticonTM Real-Time PCR detection system</italic> (Bio-Rad, Hercules, CA, USA) and KAPA <italic>SYBR</italic> FAST qPCR Kit (<italic>Kapa Biosystems</italic>, Boston, MA, USA). Polymerase-chain reaction was performed by 40 cycles at 95 °C for 30 s, 58-60 °C for 60 s, and 72 °C for 30 s. β-actin mRNA was determined as the internal control gene. The mRNA expression of each gene (<xref ref-type="table" rid="t2">Table 2</xref>) was normalized to the β-actin mRNA expression in the same sample. Threshold cycle (<italic>C</italic><sub>t</sub>) values were obtained, and relative gene expression was calculated using the formula <inline-formula>
					<mml:math display="inline" id="m1">
						<mml:mrow>
							<mml:msup>
								<mml:mrow>
									<mml:mrow>
										<mml:mo>(</mml:mo>
										<mml:mrow>
											<mml:mn>1</mml:mn>
											<mml:mtext>/</mml:mtext>
											<mml:mn>2</mml:mn>
										</mml:mrow>
										<mml:mo>)</mml:mo>
									</mml:mrow>
								</mml:mrow>
								<mml:mrow>
									<mml:mrow>
										<mml:mtext>Ct target genes-Ct</mml:mtext>
										<mml:mi mathvariant="normal">β</mml:mi>
									</mml:mrow>
									<mml:mrow>
										<mml:mtext>-actin</mml:mtext>
									</mml:mrow>
								</mml:mrow>
							</mml:msup>
						</mml:mrow>
					</mml:math>
				</inline-formula>.</p>
			<table-wrap id="t2">
				<label>Table 2</label>
				<caption>
					<title>Primer sequences for quantitative reverse transcription-PCR</title>
				</caption>
				<table frame="hsides" rules="groups">
					<colgroup width="33%">
						<col/>
						<col/>
						<col/>
					</colgroup>
					<thead style="border-top: thin solid; border-bottom: thin solid; border-color: #000000">
						<tr>
							<th align="left" valign="middle">Gene</th>
							<th align="center" valign="middle">Primer sequences (5′-3′)</th>
							<th align="center" valign="middle">Annealing temperature (°C)</th>
						</tr>
					</thead>
					<tbody style="border-bottom: thin solid; border-color: #000000">
						<tr>
							<td align="left" valign="middle"><italic>iNOS</italic></td>
							<td align="left" valign="middle">F: AGGCCAAACATCCTGGAGGTC <break/>R: TCATAGAGACGCTGCTGCCAG</td>
							<td align="center" valign="middle">60</td>
						</tr>
						<tr>
							<td align="left" valign="middle"><italic>COX-2</italic></td>
							<td align="left" valign="middle">F: AACACAATAGAGTCTGTGACGTCTT <break/>R: TATTGAATTCAGCTGCGATTCGG</td>
							<td align="center" valign="middle">60</td>
						</tr>
						<tr>
							<td align="left" valign="middle"><italic>IFN-γ</italic></td>
							<td align="left" valign="middle">F: ACACTGACAAGTCAAAGCCGCACA <break/>R: AGTCGTTCATCGGGAGCTTGGC</td>
							<td align="center" valign="middle">55</td>
						</tr>
						<tr>
							<td align="left" valign="middle"><italic>IL-1β</italic></td>
							<td align="left" valign="middle">F: CAGCCTCAGCGAAGAGACCTT <break/>R: CACTGTGGTGTGCTCAGAATCC</td>
							<td align="center" valign="middle">60</td>
						</tr>
						<tr>
							<td align="left" valign="middle"><italic>IL-4</italic></td>
							<td align="left" valign="middle">F: TGTGCCCACGCTGTGCTTACA <break/>R: CTTGTGGCAGTGCTGGCTCTCC</td>
							<td align="center" valign="middle">60.9</td>
						</tr>
						<tr>
							<td align="left" valign="middle"><italic>IL-10</italic></td>
							<td align="left" valign="middle">F: AGCAGATCAAGGAGACGTTC <break/>R: ATCAGCAGGTACTCCTCGAT</td>
							<td align="center" valign="middle">60.9</td>
						</tr>
						<tr>
							<td align="left" valign="middle"><italic>β-actin</italic></td>
							<td align="left" valign="middle">F: CATCACCATTGGCAATGAGAGG <break/>R: GGTACATTGTGGTACCACCAGAC</td>
							<td align="center" valign="middle">60</td>
						</tr>
					</tbody>
				</table>
				<table-wrap-foot>
					<fn id="TFN4">
						<p>PCR - polymerase chain reaction; <italic>iNOS</italic> - inducible nitric oxide synthase; <italic>COX-2</italic> - cyclooxygenase-2; <italic>IFN-γ</italic> - interferon-γ; <italic>IL-1β</italic> - interleukin-1β; <italic>IL-4</italic> - interleukin-4; <italic>IL-10</italic> - interleukin-10; F - forward; R - reverse.</p>
					</fn>
				</table-wrap-foot>
			</table-wrap>
			<p>All experimental data were analyzed by ANOVA using the GLM procedure of SAS (Statistical Analysis System, version 9.2) in a completely randomized design. Duncan's new multiple range test was used to evaluate differences between means. Each broiler formed the experimental unit. P-values of less than 0.05 were considered statistically significant.</p>
		</sec>
		<sec sec-type="results">
			<title>Results</title>
			<p><italic>Bacillus licheniformis</italic> SSF was optimized by studying the result of different treatments on cfu. Although the changes in <italic>Bacillus licheniformis</italic> biomass were not statistically significant, a trend of increased bacterial growth was observed with the supplementation of glucose compared with the control group (<xref ref-type="fig" rid="f1">Figure 1A</xref>). In contrast, brown sugar supplementation tended to reduce the bacterial growth (<xref ref-type="fig" rid="f1">Figure 1A</xref>). In the nitrogen resource analysis, 10% soybean meal in combination with 3% yeast supplementation revealed the highest bacterial growth compared with other treatments (<xref ref-type="fig" rid="f1">Figure 1B</xref>) (P&lt;0.05). The increased biomass production of <italic>Bacillus licheniformis</italic> in SSF was observed at the initial moisture content of 50% (<xref ref-type="fig" rid="f1">Figure 1C</xref>) (P&lt;0.05). The <italic>Bacillus licheniformis</italic> biomass in SSF was positively correlated with extended incubation period (<xref ref-type="fig" rid="f1">Figure 1D</xref>) (P&lt;0.05). A similar result was also observed in spore production, but no significant difference was found between four and six days of SSF (<xref ref-type="fig" rid="f1">Figure 1E</xref>). Together, these findings demonstrate that the optimal parameters for <italic>Bacillus licheniformis</italic> in SSF are 5% glucose and 10% soybean meal in combination with 3% yeast at the initial moisture content of 50% with extended incubation period.</p>
			<fig id="f1">
				<label>Figure 1</label>
				<caption>
					<title>Optimization of growth parameters of <italic>Bacillus licheniformis</italic> by solid-state fermentation (SSF).</title>
					<p>(A) Effect of different carbon sources (glucose and brown sugar) on bacterial count of <italic>Bacillus licheniformis</italic> in SSF. (B) Effect of different nitrogen sources (soybean meal and yeast) on bacterial count of <italic>Bacillus licheniformis</italic> in SSF. (C) Effect of different initial moisture (40-70%) on bacterial count of <italic>Bacillus licheniformis</italic> in SSF. (D) Effect of different fermentation duration (two, four, and six days) on bacterial count of <italic>Bacillus licheniformis</italic>. (E) Effect of different fermentation duration (two, four, and six days) on spore production of <italic>Bacillus licheniformis</italic>.</p>
					<p>Values were expressed as mean ± standard deviation (n = 3).</p>
					<p>Means with different letters are significantly different (P&lt;0.05).</p>
				</caption>
				<graphic xlink:href="1806-9290-rbz-48-e20170298-gf01.tif"/>
			</fig>
			<p>Heat-resistant analysis showed that fermented products produced by four and six days of SSF were highly resistant to heat compared with fermented products produced by two days of SSF (<xref ref-type="fig" rid="f2">Figure 2A</xref>) (P&lt;0.05). A similar result was also observed in acid-resistant analysis. Fermented products produced by four and six days of SSF were resistant to the acidic environment compared with fermented products produced by two days of SSF (<xref ref-type="fig" rid="f2">Figure 2B</xref>) (P&lt;0.05). However, no significant difference was found in bile salt-resistant analysis among treatments (<xref ref-type="fig" rid="f2">Figure 2C</xref>). The fermented products from two days of SSF exhibited potent antimicrobial activity against <italic>Staphylococcus aureus</italic> (<xref ref-type="fig" rid="f3">Figure 3A</xref>). The antimicrobial effects were further increased in fermented products from four and six days of SSF (<xref ref-type="fig" rid="f3">Figure 3A</xref>). In addition to <italic>Staphylococcus aureus</italic>, fermented products from six days of SSF also showed antimicrobial activity against <italic>Clostridium perfringens</italic> compared with enramycin (<xref ref-type="fig" rid="f3">Figure 3B</xref>) and ampicillin (<xref ref-type="fig" rid="f3">Figure 3C</xref>). These results demonstrate that the fermented products produced by four and six days of SSF are thermostable and acid-tolerant. The six days of <italic>Bacillus licheniformis</italic> SSF products had the highest antimicrobial activity.</p>
			<fig id="f2">
				<label>Figure 2</label>
				<caption>
					<title>Determination of tolerance of stress on spore production of <italic>Bacillus licheniformis</italic> solid-state fermentation product.</title>
					<p>(A) Effect of heat treatments (80, 90, and 100 °C) and different fermentation duration (two, four, six days) on spore production of <italic>Bacillus licheniformis</italic>. (B) Effect of acid treatments (pH 2.0, 3.0, and 4.0) and different fermentation duration (two, four, and six days) on spore production of <italic>Bacillus licheniformis</italic>. (C) Effect of bile salt treatments (0.1, 0.2, and 0.3%) and different fermentation duration (two, four, and six days) on spore production of <italic>Bacillus licheniformis</italic>.</p>
					<p>Values were expressed as mean ± standard deviation (n = 3).</p>
					<p>Means with different letters are significantly different (P&lt;0.05).</p>
				</caption>
				<graphic xlink:href="1806-9290-rbz-48-e20170298-gf02.tif"/>
			</fig>
			<fig id="f3">
				<label>Figure 3</label>
				<caption>
					<title>Assessment of antimicrobial activity of <italic>Bacillus licheniformis</italic> solid-state fermentation product.</title>
					<p>(A) Antimicrobial activity of fermented product from different fermentation durations (two, four, and six days) against <italic>Staphylococcus aureus</italic> compared with ampicillin. Three experiments were carried out, and one representative result is shown. (B) Antimicrobial activity of fermented product from different fermentation durations (two, four, and six days) against <italic>Clostridium perfringens</italic> compared with enramycin. Three experiments were carried out, and one representative result is shown. (C) Antimicrobial activity of fermented product from different fermentation durations (two, four, and six days) against <italic>Clostridium perfringens</italic> compared with ampicillin. Three experiments were carried out, and one representative result is shown.</p>
				</caption>
				<graphic xlink:href="1806-9290-rbz-48-e20170298-gf03.tif"/>
			</fig>
			<p>Our results demonstrated that <italic>Clostridium perfringens</italic> challenge could induce intestinal necrotic lesions in broilers (data not shown). To investigate what effect the SSF product from <italic>Bacillus licheniformis</italic> has on birds under <italic>Clostridium perfringens</italic> challenge, we offered the broilers a basal diet, a basal diet supplemented with antibiotics (bacitracin methylene disalicylate; BMD), and a basal diet supplemented with four or six days of <italic>Bacillus licheniformis</italic> SSF products. After feeding the diets for five weeks, no significant difference was found in the growth performance according to body weight and food intake among the groups (<xref ref-type="table" rid="t3">Table 3</xref>). Antibiotic treatment resulted in a significantly reduced FCR between day 1 and day 21 compared with the control group (<xref ref-type="table" rid="t3">Table 3</xref>) (P&lt;0.05). Although it did not reach statistical significance, four and six days of <italic>Bacillus licheniformis</italic> SSF products caused a similar trend in improving FCR in broiler chickens between day 1 and day 21 (<xref ref-type="table" rid="t3">Table 3</xref>). After 22 days of feeding, four and six days of <italic>Bacillus licheniformis</italic> SSF products efficiently alleviated the intestinal damage caused by <italic>Clostridium perfringens</italic> compared with control and antibiotic treatment (<xref ref-type="fig" rid="f4">Figure 4A</xref>) (P&lt;0.05). After feeding the diets for 35 days, no significant difference was found in the intestinal lesion scores among the groups (<xref ref-type="fig" rid="f4">Figure 4B</xref>). These findings demonstrate that the dietary fermented products of <italic>Bacillus licheniformis</italic> could inhibit the <italic>Clostridium perfringens</italic>-induced necrotic lesions in the small intestines of broilers, and these effects are more effective than commercial antibiotics.</p>
			<fig id="f4">
				<label>Figure 4</label>
				<caption>
					<title>Assessment of dietary <italic>Bacillus licheniformis</italic> solid-state fermentation product on intestinal lesion score under <italic>Clostridium perfringens</italic> challenge.</title>
					<p>(A) Effect of control (Ctrl), bacitracin methylene disalicylate (BMD), four-day fermented product (4DF), and six-day fermented product (6DF) on intestinal lesion score under <italic>Clostridium perfringens</italic> challenge in broilers at 22 days. (B) Effect of Ctrl, BMD, 4DF, and 6DF on intestinal lesion score under <italic>Clostridium perfringens</italic> challenge in broilers at 35 days.</p>
					<p>Values were expressed as mean ± standard deviation (n = 6).</p>
					<p>Means with different letters are significantly different (P&lt;0.05).</p>
				</caption>
				<graphic xlink:href="1806-9290-rbz-48-e20170298-gf04.tif"/>
			</fig>
			<table-wrap id="t3">
				<label>Table 3</label>
				<caption>
					<title>Effect of solid-state fermentation product on growth performance of broilers under <italic>Clostridium perfringens</italic> challenge</title>
				</caption>
				<table frame="hsides" rules="groups">
					<colgroup width="19%">
						<col width="1%"/>
						<col/>
						<col/>
						<col/>
						<col/>
						<col/>
					</colgroup>
					<thead style="border-top: thin solid; border-bottom: thin solid; border-color: #000000">
						<tr>
							<th align="left" colspan="2" valign="middle"/>
							<th align="center" valign="middle">Control</th>
							<th align="center" valign="middle">BMD</th>
							<th align="center" valign="middle">4DF</th>
							<th align="center" valign="middle">6DF</th>
						</tr>
					</thead>
					<tbody style="border-bottom: thin solid; border-color: #000000">
						<tr>
							<td align="left" colspan="2" valign="middle">Body weight (g)</td>
							<td align="center" valign="middle"/>
							<td align="center" valign="middle"/>
							<td align="center" valign="middle"/>
							<td align="center" valign="middle"/>
						</tr>
						<tr>
							<td align="center" valign="middle"/>
							<td align="left" valign="middle">1 day</td>
							<td align="center" valign="middle">45.07±0.93<xref ref-type="table-fn" rid="TFN6">1</xref>
							</td>
							<td align="center" valign="middle">44.29±1.51</td>
							<td align="center" valign="middle">44.41±1.36</td>
							<td align="center" valign="middle">44.64±0.58</td>
						</tr>
						<tr>
							<td align="center" valign="middle"/>
							<td align="left" valign="middle">21 days</td>
							<td align="center" valign="middle">778.33±62.84</td>
							<td align="center" valign="middle">910±103.95</td>
							<td align="center" valign="middle">841.67±97.51</td>
							<td align="center" valign="middle">884.17±52.82</td>
						</tr>
						<tr>
							<td align="center" valign="middle"/>
							<td align="left" valign="middle">35 days</td>
							<td align="center" valign="middle">1570±252.39</td>
							<td align="center" valign="middle">1533.3±122.2</td>
							<td align="center" valign="middle">1563.3±153</td>
							<td align="center" valign="middle">1660±140.8</td>
						</tr>
						<tr>
							<td align="left" colspan="2" valign="middle">Average daily gain (g)</td>
							<td align="center" valign="middle"/>
							<td align="center" valign="middle"/>
							<td align="center" valign="middle"/>
							<td align="center" valign="middle"/>
						</tr>
						<tr>
							<td align="center" valign="middle"/>
							<td align="left" valign="middle">1-21 days</td>
							<td align="center" valign="middle">34.92±3.01</td>
							<td align="center" valign="middle">41.22±4.89</td>
							<td align="center" valign="middle">37.97±4.58</td>
							<td align="center" valign="middle">39.98±2.54</td>
						</tr>
						<tr>
							<td align="center" valign="middle"/>
							<td align="left" valign="middle">21-35 days</td>
							<td align="center" valign="middle">48.69±13.97</td>
							<td align="center" valign="middle">54.17±15.94</td>
							<td align="center" valign="middle">50±5.06</td>
							<td align="center" valign="middle">51.43±7.29</td>
						</tr>
						<tr>
							<td align="left" colspan="2" valign="middle">Average daily feed intake (g)</td>
							<td align="center" valign="middle"/>
							<td align="center" valign="middle"/>
							<td align="center" valign="middle"/>
							<td align="center" valign="middle"/>
						</tr>
						<tr>
							<td align="center" valign="middle"/>
							<td align="left" valign="middle">1-21 days</td>
							<td align="center" valign="middle">71.59±3.61</td>
							<td align="center" valign="middle">64.5±7.45</td>
							<td align="center" valign="middle">65.92±1.67</td>
							<td align="center" valign="middle">68.06±3.66</td>
						</tr>
						<tr>
							<td align="center" valign="middle"/>
							<td align="left" valign="middle">21-35 days</td>
							<td align="center" valign="middle">135.83±12.16</td>
							<td align="center" valign="middle">128.09±15.75</td>
							<td align="center" valign="middle">137.62±4.12</td>
							<td align="center" valign="middle">141.19±4.12</td>
						</tr>
						<tr>
							<td align="left" colspan="2" valign="middle">Feed conversion ratio (daily feed intake/daily gain)</td>
							<td align="center" valign="middle"/>
							<td align="center" valign="middle"/>
							<td align="center" valign="middle"/>
							<td align="center" valign="middle"/>
						</tr>
						<tr>
							<td align="center" valign="middle"/>
							<td align="left" valign="middle">1-21 days</td>
							<td align="center" valign="middle">2.05±0.11a</td>
							<td align="center" valign="middle">1.59±0.32b</td>
							<td align="center" valign="middle">1.75±0.22ab</td>
							<td align="center" valign="middle">1.71±0.19ab</td>
						</tr>
						<tr>
							<td align="center" valign="middle"/>
							<td align="left" valign="middle">21-35 days</td>
							<td align="center" valign="middle">2.92±0.69</td>
							<td align="center" valign="middle">2.48±0.72</td>
							<td align="center" valign="middle">2.76±0.22</td>
							<td align="center" valign="middle">2.79±0.44</td>
						</tr>
					</tbody>
				</table>
				<table-wrap-foot>
					<fn id="TFN5">
						<p>BMD - bacitracin methylene disalicylate; 4DF - four-day fermented product; 6DF - six-day fermented product.</p>
					</fn>
					<fn id="TFN6">
						<label>1</label>
						<p>Values are expressed as mean ± standard deviation (n = 12).</p>
					</fn>
					<fn id="TFN7">
						<p>a-b - Means within a row with different letters are significantly different (P&lt;0.05).</p>
					</fn>
				</table-wrap-foot>
			</table-wrap>
			<p>Subsequently, we examined the morphology of the small intestine in broilers after SSF product treatment under <italic>Clostridium perfringens</italic> challenge. After 22 days of feeding, results showed that the villus length was significantly increased in the duodenum and jejunum in the groups treated with antibiotics and fermented products compared with the control group (<xref ref-type="table" rid="t4">Table 4</xref>) (P&lt;0.05). The antibiotics significantly reduced the duodenal crypt depth, whereas no significant difference was found in the groups treated with <italic>Bacillus licheniformis</italic> SSF products for four and six days (<xref ref-type="table" rid="t4">Table 4</xref>). By contrast, four and six days of <italic>Bacillus licheniformis</italic> SSF products remarkably reduced the jejunal crypt depth compared with the control group (<xref ref-type="table" rid="t4">Table 4</xref>) (P&lt;0.05). Similar to antibiotics, four and six days of <italic>Bacillus licheniformis</italic> SSF products significantly increased the villus length:crypt depth ratio (<xref ref-type="table" rid="t4">Table 4</xref>) (P&lt;0.05). After 35 days of feeding, six days of <italic>Bacillus licheniformis</italic> SSF products significantly increased intestinal villus length compared with the control group (<xref ref-type="table" rid="t5">Table 5</xref>) (P&lt;0.05). The antibiotics and SSF product treatments were able to reduce the jejunal crypt depth (<xref ref-type="table" rid="t5">Table 5</xref>) (P&lt;0.05). Furthermore, villus length:crypt depth ratio in the duodenum was elevated after antibiotics and SSF product treatments (<xref ref-type="table" rid="t5">Table 5</xref>) (P&lt;0.05). Taken together, these results indicate that the SSF products from <italic>Bacillus licheniformis</italic> reveal similar effects on improving morphology of the small intestine in broilers under <italic>Clostridium perfringens</italic> challenge.</p>
			<table-wrap id="t4">
				<label>Table 4</label>
				<caption>
					<title>Assessment of dietary <italic>Bacillus licheniformis</italic> solid-state fermentation product on morphology of small intestine of broiler chickens challenged with <italic>Clostridium perfringens</italic> at 22 days</title>
				</caption>
				<table frame="hsides" rules="groups">
					<colgroup width="16%">
						<col/>
						<col/>
						<col/>
						<col/>
						<col/>
						<col/>
					</colgroup>
					<thead style="border-top: thin solid; border-bottom: thin solid; border-color: #000000">
						<tr>
							<th align="left" valign="middle"/>
							<th align="center" valign="middle"/>
							<th align="center" valign="middle">Control</th>
							<th align="center" valign="middle">BMD</th>
							<th align="center" valign="middle">4DF</th>
							<th align="center" valign="middle">6DF</th>
						</tr>
					</thead>
					<tbody style="border-bottom: thin solid; border-color: #000000">
						<tr>
							<td align="left" valign="middle">Villus length (μm)</td>
							<td align="left" valign="middle">Duodenum</td>
							<td align="center" valign="middle">3974.94±825.80<xref ref-type="table-fn" rid="TFN9">1</xref>a</td>
							<td align="center" valign="middle">8245.76±968.71b</td>
							<td align="center" valign="middle">11482.11±818.79c</td>
							<td align="center" valign="middle">10828.02±1069.42c</td>
						</tr>
						<tr>
							<td align="left" valign="middle"/>
							<td align="left" valign="middle">Jejunum</td>
							<td align="center" valign="middle">3979.33±650.62a</td>
							<td align="center" valign="middle">9418.04±3468.71b</td>
							<td align="center" valign="middle">8888.31±1461.85b</td>
							<td align="center" valign="middle">7529.44±2677.54b</td>
						</tr>
						<tr>
							<td align="left" valign="middle"/>
							<td align="left" valign="middle">Ileum</td>
							<td align="center" valign="middle">3470.01±1396.47ab</td>
							<td align="center" valign="middle">4948.36±662.39a</td>
							<td align="center" valign="middle">6728±886.42c</td>
							<td align="center" valign="middle">2495.73±2164.91b</td>
						</tr>
						<tr>
							<td align="left" valign="middle"/>
							<td align="left" valign="middle"/>
							<td align="center" valign="middle"/>
							<td align="center" valign="middle"/>
							<td align="center" valign="middle"/>
							<td align="center" valign="middle"/>
						</tr>
						<tr>
							<td align="left" valign="middle">Crypt depth (μm)</td>
							<td align="left" valign="middle">Duodenum</td>
							<td align="center" valign="middle">2249.06±451.22a</td>
							<td align="center" valign="middle">1696.64±137.47b</td>
							<td align="center" valign="middle">1790.84±383.33ab</td>
							<td align="center" valign="middle">2107.54±462.85ab</td>
						</tr>
						<tr>
							<td align="left" valign="middle"/>
							<td align="left" valign="middle">Jejunum</td>
							<td align="center" valign="middle">2245.83±575.87a</td>
							<td align="center" valign="middle">1795.24±309.79ab</td>
							<td align="center" valign="middle">1438.71±279.4b</td>
							<td align="center" valign="middle">1454.78±247.21b</td>
						</tr>
						<tr>
							<td align="left" valign="middle"/>
							<td align="left" valign="middle">Ileum</td>
							<td align="center" valign="middle">1628.64±287.63ab</td>
							<td align="center" valign="middle">1354.62±95.55a</td>
							<td align="center" valign="middle">1800.81±369.16b</td>
							<td align="center" valign="middle">1712.65±331.22ab</td>
						</tr>
						<tr>
							<td align="left" valign="middle"/>
							<td align="left" valign="middle"/>
							<td align="center" valign="middle"/>
							<td align="center" valign="middle"/>
							<td align="center" valign="middle"/>
							<td align="center" valign="middle"/>
						</tr>
						<tr>
							<td align="left" rowspan="3" valign="middle">Villus length:crypt depth</td>
							<td align="left" valign="middle">Duodenum</td>
							<td align="center" valign="middle">1.77267±0.19a</td>
							<td align="center" valign="middle">4.87117±0.58b</td>
							<td align="center" valign="middle">6.65317±1.42c</td>
							<td align="center" valign="middle">5.38417±1.44bc</td>
						</tr>
						<tr>
							<td align="left" valign="middle">Jejunum</td>
							<td align="center" valign="middle">1.85483±0.52a</td>
							<td align="center" valign="middle">5.138±1.3b</td>
							<td align="center" valign="middle">6.1025±1.04b</td>
							<td align="center" valign="middle">5.2665±1.21b</td>
						</tr>
						<tr>
							<td align="left" valign="middle">Ileum</td>
							<td align="center" valign="middle">2.0845±0.60a</td>
							<td align="center" valign="middle">3.65483±0.41b</td>
							<td align="center" valign="middle">3.79117±0.4b</td>
							<td align="center" valign="middle">2.433±0.78a</td>
						</tr>
					</tbody>
				</table>
				<table-wrap-foot>
					<fn id="TFN8">
						<p>BMD - bacitracin methylene disalicylate; 4DF - four-day fermented product; 6DF - six-day fermented product.</p>
					</fn>
					<fn id="TFN9">
						<label>1</label>
						<p>Values are expressed as mean ± standard deviation (n = 12).</p>
					</fn>
					<fn id="TFN10">
						<p>a-c - Means within a row with different letters are significantly different (P&lt;0.05).</p>
					</fn>
				</table-wrap-foot>
			</table-wrap>
			<table-wrap id="t5">
				<label>Table 5</label>
				<caption>
					<title>Assessment of dietary <italic>Bacillus licheniformis</italic> solid-state fermentation product on morphology of small intestine of broiler chickens challenged with <italic>Clostridium perfringens</italic> at 35 days</title>
				</caption>
				<table frame="hsides" rules="groups">
					<colgroup width="16%">
						<col/>
						<col/>
						<col/>
						<col/>
						<col/>
						<col/>
					</colgroup>
					<thead style="border-top: thin solid; border-bottom: thin solid; border-color: #000000">
						<tr>
							<th align="left" valign="middle"/>
							<th align="left" valign="middle"/>
							<th align="center" valign="middle">Control</th>
							<th align="center" valign="middle">BMD</th>
							<th align="center" valign="middle">4DF</th>
							<th align="center" valign="middle">6DF</th>
						</tr>
					</thead>
					<tbody style="border-bottom: thin solid; border-color: #000000">
						<tr>
							<td align="left" valign="middle">Villus length (μm)</td>
							<td align="left" valign="middle">Duodenum</td>
							<td align="center" valign="middle">5551.47±988.83<xref ref-type="table-fn" rid="TFN12">1</xref>a</td>
							<td align="center" valign="middle">11699.92±2306.11b</td>
							<td align="center" valign="middle">4734.51±4341.73a</td>
							<td align="center" valign="middle">10949.89±970.20b</td>
						</tr>
						<tr>
							<td align="left" valign="middle"/>
							<td align="left" valign="middle">Jejunum</td>
							<td align="center" valign="middle">3217.23±1535.78a</td>
							<td align="center" valign="middle">6808.01±611.15b</td>
							<td align="center" valign="middle">9421.9±561.36c</td>
							<td align="center" valign="middle">8387.11±1356.65c</td>
						</tr>
						<tr>
							<td align="left" valign="middle"/>
							<td align="left" valign="middle">Ileum</td>
							<td align="center" valign="middle">5657.58±1185.28a</td>
							<td align="center" valign="middle">4811.71±622.69a</td>
							<td align="center" valign="middle">5637.28±1574.07a</td>
							<td align="center" valign="middle">7910.8±3528.21b</td>
						</tr>
						<tr>
							<td align="left" valign="middle">Crypt depth (μm)</td>
							<td align="left" valign="middle">Duodenum</td>
							<td align="center" valign="middle">1524.39±428.94</td>
							<td align="center" valign="middle">1558.49±429.49</td>
							<td align="center" valign="middle">1350.97±184.70</td>
							<td align="center" valign="middle">1833.17±172.66</td>
						</tr>
						<tr>
							<td align="left" valign="middle"/>
							<td align="left" valign="middle">Jejunum</td>
							<td align="center" valign="middle">2505.75±470.09a</td>
							<td align="center" valign="middle">1553.65±170.24b</td>
							<td align="center" valign="middle">1442.09±364.33b</td>
							<td align="center" valign="middle">1613.45±444.91b</td>
						</tr>
						<tr>
							<td align="left" valign="middle"/>
							<td align="left" valign="middle">Ileum</td>
							<td align="center" valign="middle">1674.17±447.19ab</td>
							<td align="center" valign="middle">2292.23±1237.95a</td>
							<td align="center" valign="middle">1193.41±146.17b</td>
							<td align="center" valign="middle">1334.74±435.94ab</td>
						</tr>
						<tr>
							<td align="left" valign="middle"/>
							<td align="left" valign="middle"/>
							<td align="center" valign="middle"/>
							<td align="center" valign="middle"/>
							<td align="center" valign="middle"/>
							<td align="center" valign="middle"/>
						</tr>
						<tr>
							<td align="left" rowspan="2" valign="middle">Villus length:crypt depth</td>
							<td align="left" valign="middle">Duodenum</td>
							<td align="center" valign="middle">3.77883±0.76a</td>
							<td align="center" valign="middle">7.71367±1.21b</td>
							<td align="center" valign="middle">5.47150±1.90c</td>
							<td align="center" valign="middle">6.01517±0.78c</td>
						</tr>
						<tr>
							<td align="left" valign="middle">Jejunum</td>
							<td align="center" valign="middle">3.393±1.57a</td>
							<td align="center" valign="middle">4.42717±0.61a</td>
							<td align="center" valign="middle">6.94883±2.04b</td>
							<td align="center" valign="middle">5.40517±0.98ab</td>
						</tr>
						<tr>
							<td align="left" valign="middle"/>
							<td align="left" valign="middle">Ileum</td>
							<td align="center" valign="middle">3.43866±0.39ab</td>
							<td align="center" valign="middle">2.71083±1.4a</td>
							<td align="center" valign="middle">4.75683±1.42c</td>
							<td align="center" valign="middle">5.789±1.45bc</td>
						</tr>
					</tbody>
				</table>
				<table-wrap-foot>
					<fn id="TFN11">
						<p>BMD - bacitracin methylene disalicylate; 4DF - four-day fermented product; 6DF - six-day fermented product.</p>
					</fn>
					<fn id="TFN12">
						<label>1</label>
						<p>Values are expressed as mean ± standard deviation (n = 12).</p>
					</fn>
					<fn id="TFN13">
						<p>a-c - Means within a row with different letters are significantly different (P&lt;0.05).</p>
					</fn>
				</table-wrap-foot>
			</table-wrap>
			<p>After 22 days of feeding, we found no statistically significant difference in the expression of <italic>iNOS</italic> and <italic>COX-2</italic> genes in the spleen of broilers from the control and SSF product-treated groups (<xref ref-type="fig" rid="f5">Figure 5A</xref>). The expression of <italic>IL-1β</italic> gene of broilers in the six-day SSF product-treated group was greater than in the broilers treated with antibiotics (<xref ref-type="fig" rid="f5">Figure 5A</xref>) (P&lt;0.05). Similarly, six days of SSF products remarkably induced <italic>IFN-γ</italic> mRNA expression in the spleen of broilers compared with the control (<xref ref-type="fig" rid="f5">Figure 5A</xref>) (P&lt;0.05). No significant difference was found in the expression of the <italic>IL-4</italic> and <italic>IL-10</italic> genes in the spleen of broilers between the control and SSF product-treated groups (<xref ref-type="fig" rid="f5">Figure 5A</xref>).</p>
			<fig id="f5">
				<label>Figure 5</label>
				<caption>
					<title>Examination of dietary <italic>Bacillus licheniformis</italic> solid-state fermentation product on mRNA expression in spleens of broiler chickens challenged with <italic>Clostridium perfringens</italic>.</title>
					<p>(A) Effect of control (Ctrl), bacitracin methylene disalicylate (BMD), four-day fermented product (4DF), and six-day fermented product (6DF) on inducible nitric oxide synthase (<italic>iNOS</italic>), cyclooxygenase-2 (<italic>COX-2</italic>), interleukin-1β (<italic>IL-1β</italic>), interferon γ (<italic>IFN-</italic>γ), interleukin-4 (<italic>IL-4</italic>), and interleukin-10 (<italic>IL-10</italic>) mRNA expression in spleens of <italic>Clostridium perfringens</italic>-challenged broilers at 22 days. (B) Effect of Ctrl, BMD, 4DF, and 6DF on <italic>iNOS, COX-2, IL-1β, IFN-γ, IL-4</italic>, and <italic>IL-10</italic> mRNA expression in spleens of <italic>Clostridium perfringens</italic>-challenged broilers at 35 days.</p>
					<p>Values are expressed as mean ± standard deviation (n = 6).</p>
					<p>Means with different letters are significantly different (P&lt;0.05).</p>
				</caption>
				<graphic xlink:href="1806-9290-rbz-48-e20170298-gf05.tif"/>
			</fig>
			<p>After feeding the diets for 35 days, the expression of <italic>iNOS</italic> gene was elevated in the spleen of boilers from the groups treated with antibiotics and six days of SSF product (<xref ref-type="fig" rid="f5">Figure 5B</xref>) (P&lt;0.05). The antibiotics treatment significantly promoted the <italic>COX-2</italic> mRNA expression (<xref ref-type="fig" rid="f5">Figure 5B</xref>) (P&lt;0.05). However, although a slight increase in <italic>COX-2</italic> mRNA expression was observed in the SSF product-treated groups, no statistically significant difference between the control and the SSF product-treated groups were found in the spleen (<xref ref-type="fig" rid="f5">Figure 5B</xref>). The antibiotics and SSF product-treated groups consistently showed increased <italic>IL-1β</italic> and <italic>IFN-γ</italic> mRNA expression in the spleen compared with the control group (<xref ref-type="fig" rid="f5">Figure 5B</xref>; P&lt;0.05). No significant difference was observed in the expression of <italic>IL-4</italic> and <italic>IL-10</italic> genes in the spleen of control and SSF product-treated group (<xref ref-type="fig" rid="f5">Figure 5B</xref>).</p>
			<p>Four days of SSF products significantly increased <italic>iNOS</italic> mRNA expression in the bursa of Fabricius (<xref ref-type="fig" rid="f6">Figure 6A</xref>; P&lt;0.05). No significant difference was found in the expression of <italic>COX-2</italic> gene in the bursa of Fabricius between the control and SSF product-treated groups (<xref ref-type="fig" rid="f6">Figure 6A</xref>). The antibiotics- and SSF product-treated groups consistently increased <italic>IL-1β</italic> mRNA expression in the bursa of Fabricius compared with the control group (<xref ref-type="fig" rid="f6">Figure 6A</xref>; P&lt;0.05). The expression of <italic>IFN-γ</italic> gene was remarkably induced in four and six days of SSF product-treated groups (<xref ref-type="fig" rid="f6">Figure 6A</xref>; P&lt;0.05). The expression of <italic>IL-4</italic> gene in the six days of SSF product-treated group was remarkably reduced compared with control group (<xref ref-type="fig" rid="f6">Figure 6A</xref>; P&lt;0.05). No significant difference was found in the expression of <italic>IL-10</italic> gene in the bursa of Fabricius between the control and SSF product-treated groups (<xref ref-type="fig" rid="f6">Figure 6A</xref>).</p>
			<fig id="f6">
				<label>Figure 6</label>
				<caption>
					<title>Examination of dietary <italic>Bacillus licheniformis</italic> solid-state fermentation product on mRNA expression in bursa of Fabricius of broiler chickens challenged with <italic>Clostridium perfringens</italic>.</title>
					<p>(A) Effect of control (Ctrl), bacitracin methylene disalicylate (BMD), four-day fermented product (4DF), and six-day fermented product (6DF) on inducible nitric oxide synthase (<italic>iNOS</italic>), cyclooxygenase-2 (<italic>COX-2</italic>), interleukin-1β (<italic>IL-1β</italic>), interferon γ (<italic>IFN-γ</italic>), interleukin-4 (<italic>IL-4</italic>), and interleukin-10 (<italic>IL-10</italic>) mRNA expression in bursa of Fabricius of <italic>Clostridium perfringens</italic>-challenged broilers at 22 days. (B) Effect of Ctrl, BMD, 4DF, and 6DF on <italic>iNOS, COX-2, IL-1β, IFN-γ, IL-4</italic>, and <italic>IL-10</italic> mRNA expression in bursa of Fabricius of <italic>Clostridium perfringens</italic>-challenged broilers at 35 days.</p>
					<p>Values are expressed as mean ± standard deviation (n = 6).</p>
					<p>Means with different letters are significantly different (P&lt;0.05).</p>
				</caption>
				<graphic xlink:href="1806-9290-rbz-48-e20170298-gf06.tif"/>
			</fig>
			<p>Four and six days of <italic>Bacillus licheniformis</italic> SSF products significantly reduced <italic>iNOS</italic> mRNA expression in the bursa of Fabricius (<xref ref-type="fig" rid="f6">Figure 6B</xref>; P&lt;0.05). No significant difference was found in the expression of <italic>COX-2</italic> and <italic>IL-1β</italic> genes in the bursa of Fabricius of the control and SSF product-treated groups (<xref ref-type="fig" rid="f6">Figure 6B</xref>). Similar to the spleen, the antibiotics and SSF products remarkably induced <italic>IFN-γ</italic> mRNA expression in the bursa of Fabricius compared with the control group (<xref ref-type="fig" rid="f6">Figure 6B</xref>; P&lt;0.05). The antibiotics and SSF products consistently attenuated the <italic>IL-4</italic> mRNA expression (<xref ref-type="fig" rid="f6">Figure 6B</xref>; P&lt;0.05). Six days of <italic>Bacillus licheniformis</italic> SSF products were able to inhibit the <italic>IL-10</italic> mRNA expression compared with control group (<xref ref-type="fig" rid="f6">Figure 6B</xref>) (P&lt;0.05). These findings demonstrate that, similar to antibiotics treatment, dietary <italic>Bacillus licheniformis</italic> SSF products exhibit an immunomodulatory role in broilers under <italic>Clostridium perfringens</italic> challenge.</p>
		</sec>
		<sec sec-type="discussion">
			<title>Discussion</title>
			<p>In this study, we demonstrated that the ideal culture conditions for <italic>Bacillus licheniformis</italic> yield in SSF are 5% glucose, 10% soybean meal, 3% yeast, and 50% initial moisture content. The <italic>Bacillus licheniformis</italic> SSF product from four and six days of SSF were heat- and acid-resistant. The fermented products were able to inhibit the growth of <italic>Clostridium perfringens</italic> and <italic>Staphylococcus aureus in vitro</italic>. In feeding trial experiments, dietary supplementation of <italic>Bacillus licheniformis-</italic>fermented products significantly improved the morphology of the small intestine and alleviated the intestinal necrotic lesions under <italic>Clostridium perfringens</italic> challenge.</p>
			<p>It has been reported that the growth of <italic>Bacillus licheniformis</italic> is significantly increased on soybean-based substrate, and macromolecules of soybean are efficiently degraded to water-soluble low molecular weight compounds during SSF (<xref ref-type="bibr" rid="B16">Kiers et al., 2000</xref>). The mixture of wheat bran and rice straw powder could be used as substrates for growth of <italic>Bacillus licheniformis</italic> in SSF (<xref ref-type="bibr" rid="B33">Zhao et al., 2008</xref>). Furthermore, the spore yield of <italic>Bacillus licheniformis</italic> is increased by using wheat bran and rice straw powder supplemented with glucose (<xref ref-type="bibr" rid="B33">Zhao et al., 2008</xref>). In this study, we also found that supplementation of glucose tended to improve the growth of <italic>Bacillus licheniformis</italic> on wheat bran and soybean meal-based substrates. Extra nitrogen source, such as yeast extract, also elevates the spore production of <italic>Bacillus licheniformis</italic> using wheat bran and rice straw powder substrates (<xref ref-type="bibr" rid="B33">Zhao et al., 2008</xref>). In contrast, we found that the concentration of yeast extract was not positively correlated with the growth of <italic>Bacillus licheniformis</italic> in the present study. It has been shown that the optimal initial moisture content for spore yield of <italic>Bacillus licheniformis</italic> is 65% at 37 °C (<xref ref-type="bibr" rid="B33">Zhao et al., 2008</xref>). However, we found that the maximum spore yield of <italic>Bacillus licheniformis</italic> was obtained at 30 °C with an initial moisture content of 50%. In addition to the growth of <italic>Bacillus licheniformis</italic>, we provide further evidence that <italic>Bacillus licheniformis</italic> SSF product was heat- and acid-resistant. Whether different incubation temperatures and the combinations of substrate in SSF coordinately affect the growth of <italic>Bacillus licheniformis</italic> and ability of fermented product to resist a harsh environment remain to be further investigated.</p>
			<p>Many studies have reported that dietary supplementation of <italic>Bacillus subtilis</italic> can prevent NE in broiler chickens by competitive exclusion of <italic>Clostridium perfringens</italic> in the gastrointestinal tract (<xref ref-type="bibr" rid="B20">La Ragione and Woodward, 2003</xref>; <xref ref-type="bibr" rid="B28">Tactacan et al., 2013</xref>; <xref ref-type="bibr" rid="B12">Jayaraman et al., 2013</xref>; <xref ref-type="bibr" rid="B5">Cheng et al., 2018</xref>). It has been shown that <italic>Bacillus licheniformis</italic> isolated from broiler gastrointestinal tract reveals antimicrobial activity against a broad spectrum of pathogens, such as <italic>Clostridium perfringens in vitro</italic> (<xref ref-type="bibr" rid="B3">Barbosa et al., 2005</xref>). In the last few decades, several studies have identified that <italic>Bacillus licheniformis</italic> is able to produce bacteriocin-like antimicrobial compounds (<xref ref-type="bibr" rid="B32">Yakimov et al., 1995</xref>; <xref ref-type="bibr" rid="B26">Pattnaik et al., 2001</xref>; <xref ref-type="bibr" rid="B14">Kayalvizhi and Gunasekaran, 2008</xref>; <xref ref-type="bibr" rid="B9">Guo et al., 2012</xref>). In the present study, we also demonstrated that the <italic>Bacillus licheniformis</italic> SSF product was able to inhibit the growth of <italic>Clostridium perfringens</italic> and <italic>Staphylococcus aureus in vitro</italic>. Dietary supplementation of <italic>Bacillus licheniformis</italic> spores or virginiamycin in broilers exhibit similar effects on reduction of NE-induced lesion score and mortality (<xref ref-type="bibr" rid="B18">Knap et al., 2010</xref>). Consistently, the present data also demonstrate that dietary fermented products from <italic>Bacillus licheniformis</italic> could reduce NE-induced lesion score caused by <italic>Clostridium perfringens</italic> in the small intestines of broilers, and these effects are more effective than commercial antibiotics. We also provide further evidence that SSF product from <italic>Bacillus licheniformis</italic> can improve the morphology of the small intestine under <italic>Clostridium perfringens</italic> challenge. Taken together, these findings demonstrate that <italic>Bacillus licheniformis</italic> spores or SSF product from <italic>Bacillus licheniformis</italic> are able to ameliorate <italic>Clostridium perfringens</italic>-induced intestinal necrotic lesions in broilers. Whether and how antimicrobial substances are produced from <italic>Bacillus licheniformis</italic> during SSF and fermented product directly inhibits the growth of <italic>Clostridium perfringens in vivo</italic> remains to be investigated in future studies.</p>
			<p>T-helper 1 (Th1) and T-helper 2 (Th2) cells regulate distinct immune response pathways (<xref ref-type="bibr" rid="B17">Kidd, 2003</xref>). The balance between Th1 and Th2 cells is important for a healthy immune response (<xref ref-type="bibr" rid="B10">Halonen et al., 2009</xref>). T-helper 1 cells initiate the cellular immunity to fight pathogens, while Th2 cells drive the humoral immunity and eliminate pathogens by up-regulating antibody production (<xref ref-type="bibr" rid="B17">Kidd, 2003</xref>). It has been demonstrated that <italic>IL-1β</italic> could stimulate <italic>IFN-γ</italic> production in natural killer cells (<xref ref-type="bibr" rid="B6">Cooper et al., 2001</xref>). Here, we found that <italic>IL-1β</italic> mRNA levels were elevated in spleen and bursa of Fabricius of broilers from SSF product-treated groups under <italic>Clostridium perfringens</italic> challenge, thereby increasing the Th1 cytokine mRNA levels, such as <italic>IFN-γ</italic>. These findings indicate that <italic>Bacillus licheniformis</italic> tends to trigger the cellular immune responses in broiler chickens challenged with <italic>Clostridium perfringens</italic>.</p>
		</sec>
		<sec sec-type="conclusions">
			<title>Conclusions</title>
			<p>The optimum conditions for <italic>Bacillus licheniformis</italic> in solid-state fermentation is 5% glucose, 10% soybean meal, 3% yeast, and 50% initial moisture content. The fermented products in dietary feed can ameliorate <italic>Clostridium perfringens</italic>-induced intestinal necrotic lesions in broilers. Thus, <italic>Bacillus licheniformis</italic> solid-state fermentation product might provide an alternative source for preventing antibiotic-resistant pathogens in chickens or a substitute for antibiotics to treat <italic>Clostridium perfringens</italic>.</p>
		</sec>
	</body>
	<back>
		<ack>
			<title>Acknowledgments</title>
			<p>This work was supported by the Agricultural Technology Research Institute (10610068), Chung Cheng Agriculture Science and Social Welfare Foundation (106-3), and Ministry of Science and Technology (MOST 107-2321-B-197-002) of Taiwan. The first and second authors contributed equally to this work.</p>
		</ack>
		<ref-list>
			<title>References</title>
			<ref id="B1">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Abudabos</surname>
							<given-names>A. M.</given-names>
						</name>
						<name>
							<surname>Alyemni</surname>
							<given-names>A. H.</given-names>
						</name>
						<name>
							<surname>Dafalla</surname>
							<given-names>Y. M.</given-names>
						</name>
						<name>
							<surname>Khan</surname>
							<given-names>R. U.</given-names>
						</name>
					</person-group>
					<year>2018</year>
					<article-title>The effect of phytogenics on growth traits, blood biochemical and intestinal histology in broiler chickens exposed to <italic>Clostridium perfringens</italic> challenge</article-title>
					<source>Journal of Applied Animal Research</source>
					<volume>46</volume>
					<fpage>691</fpage>
					<lpage>695</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1080/09712119.2017.1383258">https://doi.org/10.1080/09712119.2017.1383258</ext-link>
					</comment>
				</element-citation>
				<mixed-citation>Abudabos, A. M.; Alyemni, A. H.; Dafalla, Y. M. and Khan, R. U. 2018. The effect of phytogenics on growth traits, blood biochemical and intestinal histology in broiler chickens exposed to <italic>Clostridium perfringens</italic> challenge. Journal of Applied Animal Research 46:691-695. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1080/09712119.2017.1383258">https://doi.org/10.1080/09712119.2017.1383258</ext-link>
				</mixed-citation>
			</ref>
			<ref id="B2">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Al-Sagan</surname>
							<given-names>A. A.</given-names>
						</name>
						<name>
							<surname>Abudabos</surname>
							<given-names>A. M.</given-names>
						</name>
					</person-group>
					<year>2017</year>
					<article-title>Effect of a prebiotic, probiotic and symbiotic on performance of broilers under <italic>Clostridium perfringens</italic> challenge</article-title>
					<source>The Thai Journal of Veterinary Medicine</source>
					<volume>47</volume>
					<fpage>257</fpage>
					<lpage>264</lpage>
				</element-citation>
				<mixed-citation>Al-Sagan, A. A. and Abudabos, A. M. 2017. Effect of a prebiotic, probiotic and symbiotic on performance of broilers under <italic>Clostridium perfringens</italic> challenge. The Thai Journal of Veterinary Medicine 47:257-264.</mixed-citation>
			</ref>
			<ref id="B3">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Barbosa</surname>
							<given-names>T. M.</given-names>
						</name>
						<name>
							<surname>Serra</surname>
							<given-names>C. R.</given-names>
						</name>
						<name>
							<surname>La Ragione</surname>
							<given-names>R. M.</given-names>
						</name>
						<name>
							<surname>Woodward</surname>
							<given-names>M. J.</given-names>
						</name>
						<name>
							<surname>Henriques</surname>
							<given-names>A. O.</given-names>
						</name>
					</person-group>
					<year>2005</year>
					<article-title>Screening for <italic>Bacillus</italic> isolates in the broiler gastrointestinal tract</article-title>
					<source>Applied and Environmental Microbiology</source>
					<volume>71</volume>
					<fpage>968</fpage>
					<lpage>978</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1128%2FAEM.71.2.968-978.2005">https://doi.org/10.1128%2FAEM.71.2.968-978.2005</ext-link>
					</comment>
				</element-citation>
				<mixed-citation>Barbosa, T. M.; Serra, C. R.; La Ragione, R. M.; Woodward, M. J. and Henriques, A. O. 2005. Screening for <italic>Bacillus</italic> isolates in the broiler gastrointestinal tract. Applied and Environmental Microbiology 71:968-978. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1128%2FAEM.71.2.968-978.2005">https://doi.org/10.1128%2FAEM.71.2.968-978.2005</ext-link>
				</mixed-citation>
			</ref>
			<ref id="B4">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Caly</surname>
							<given-names>D. L.</given-names>
						</name>
						<name>
							<surname>D’Inca</surname>
							<given-names>R.</given-names>
						</name>
						<name>
							<surname>Auclair</surname>
							<given-names>E.</given-names>
						</name>
						<name>
							<surname>Drider</surname>
							<given-names>D.</given-names>
						</name>
					</person-group>
					<year>2015</year>
					<article-title>Alternatives to antibiotics to prevent necrotic enteritis in broiler chickens: a microbiologist's perspective</article-title>
					<source>Frontiers in Microbiology</source>
					<volume>6</volume>
					<fpage>1336</fpage>
					<lpage>1336</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3389/fmicb.2015.01336">https://doi.org/10.3389/fmicb.2015.01336</ext-link>
					</comment>
				</element-citation>
				<mixed-citation>Caly, D. L.; D’Inca, R.; Auclair, E. and Drider, D. 2015. Alternatives to antibiotics to prevent necrotic enteritis in broiler chickens: a microbiologist's perspective. Frontiers in Microbiology 6:1336. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3389/fmicb.2015.01336">https://doi.org/10.3389/fmicb.2015.01336</ext-link>
				</mixed-citation>
			</ref>
			<ref id="B5">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Cheng</surname>
							<given-names>Y. H.</given-names>
						</name>
						<name>
							<surname>Zhang</surname>
							<given-names>N.</given-names>
						</name>
						<name>
							<surname>Han</surname>
							<given-names>J. C.</given-names>
						</name>
						<name>
							<surname>Chang</surname>
							<given-names>C. W.</given-names>
						</name>
						<name>
							<surname>Hsiao</surname>
							<given-names>F. S.</given-names>
						</name>
						<name>
							<surname>Yu</surname>
							<given-names>Y. H.</given-names>
						</name>
					</person-group>
					<year>2018</year>
					<article-title>Optimization of surfactin production from <italic>Bacillus subtilis</italic> in fermentation and its effects on <italic>Clostridium perfringens</italic>-induced necrotic enteritis and growth performance in broilers</article-title>
					<source>Journal of Animal Physiology and Animal Nutrition</source>
					<volume>102</volume>
					<fpage>1232</fpage>
					<lpage>1244</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1111/jpn.12937">https://doi.org/10.1111/jpn.12937</ext-link>
					</comment>
				</element-citation>
				<mixed-citation>Cheng, Y. H.; Zhang, N.; Han, J. C.; Chang, C. W.; Hsiao, F. S. and Yu, Y. H. 2018. Optimization of surfactin production from <italic>Bacillus subtilis</italic> in fermentation and its effects on <italic>Clostridium perfringens</italic>-induced necrotic enteritis and growth performance in broilers. Journal of Animal Physiology and Animal Nutrition 102:1232-1244. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1111/jpn.12937">https://doi.org/10.1111/jpn.12937</ext-link>
				</mixed-citation>
			</ref>
			<ref id="B6">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Cooper</surname>
							<given-names>M. A.</given-names>
						</name>
						<name>
							<surname>Fehniger</surname>
							<given-names>T. A.</given-names>
						</name>
						<name>
							<surname>Ponnappan</surname>
							<given-names>A.</given-names>
						</name>
						<name>
							<surname>Mehta</surname>
							<given-names>V.</given-names>
						</name>
						<name>
							<surname>Wewers</surname>
							<given-names>M. D.</given-names>
						</name>
						<name>
							<surname>Caligiuri</surname>
							<given-names>M. A.</given-names>
						</name>
					</person-group>
					<year>2001</year>
					<article-title>Interleukin-1β costimulates interferon-γ production by human natural killer cells</article-title>
					<source>European Journal of Immunology</source>
					<volume>31</volume>
					<fpage>792</fpage>
					<lpage>801</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1002/1521-4141(200103)31:3%3C792::AID-IMMU792%3E3.0.CO;2-U">https://doi.org/10.1002/1521-4141(200103)31:3%3C792::AID-IMMU792%3E3.0.CO;2-U</ext-link>
					</comment>
				</element-citation>
				<mixed-citation>Cooper, M. A.; Fehniger, T. A.; Ponnappan, A.; Mehta, V.; Wewers, M. D. and Caligiuri, M. A. 2001. Interleukin-1β costimulates interferon-γ production by human natural killer cells. European Journal of Immunology 31:792-801. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1002/1521-4141(200103)31:3%3C792::AID-IMMU792%3E3.0.CO;2-U">https://doi.org/10.1002/1521-4141(200103)31:3%3C792::AID-IMMU792%3E3.0.CO;2-U</ext-link>
				</mixed-citation>
			</ref>
			<ref id="B7">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Dahiya</surname>
							<given-names>J. P.</given-names>
						</name>
						<name>
							<surname>Hoehler</surname>
							<given-names>D.</given-names>
						</name>
						<name>
							<surname>Wilkie</surname>
							<given-names>D. C.</given-names>
						</name>
						<name>
							<surname>Van Kessel</surname>
							<given-names>A. G.</given-names>
						</name>
						<name>
							<surname>Drew</surname>
							<given-names>M. D.</given-names>
						</name>
					</person-group>
					<year>2005</year>
					<article-title>Dietary glycine concentration affects intestinal <italic>Clostridium perfringens</italic> and <italic>lactobacilli</italic> populations in broiler chickens</article-title>
					<source>Poultry Science</source>
					<volume>84</volume>
					<fpage>1875</fpage>
					<lpage>1885</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1093/ps/84.12.1875">https://doi.org/10.1093/ps/84.12.1875</ext-link>
					</comment>
				</element-citation>
				<mixed-citation>Dahiya, J. P.; Hoehler, D.; Wilkie, D. C.; Van Kessel, A. G. and Drew, M. D. 2005. Dietary glycine concentration affects intestinal <italic>Clostridium perfringens</italic> and <italic>lactobacilli</italic> populations in broiler chickens. Poultry Science 84:1875-1885. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1093/ps/84.12.1875">https://doi.org/10.1093/ps/84.12.1875</ext-link>
				</mixed-citation>
			</ref>
			<ref id="B8">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>el-Bendary</surname>
							<given-names>M. A.</given-names>
						</name>
					</person-group>
					<year>2006</year>
					<article-title><italic>Bacillus thuringiensis</italic> and <italic>Bacillus sphaericus</italic> biopesticides production</article-title>
					<source>Journal of Basic Microbiology</source>
					<volume>46</volume>
					<fpage>158</fpage>
					<lpage>170</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1002/jobm.200510585">https://doi.org/10.1002/jobm.200510585</ext-link>
					</comment>
				</element-citation>
				<mixed-citation>el-Bendary, M. A. 2006. <italic>Bacillus thuringiensis</italic> and <italic>Bacillus sphaericus</italic> biopesticides production. Journal of Basic Microbiology 46:158-170. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1002/jobm.200510585">https://doi.org/10.1002/jobm.200510585</ext-link>
				</mixed-citation>
			</ref>
			<ref id="B9">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Guo</surname>
							<given-names>Y.</given-names>
						</name>
						<name>
							<surname>Yu</surname>
							<given-names>Z.</given-names>
						</name>
						<name>
							<surname>Xie</surname>
							<given-names>J.</given-names>
						</name>
						<name>
							<surname>Zhang</surname>
							<given-names>R.</given-names>
						</name>
					</person-group>
					<year>2012</year>
					<article-title>Identification of a new <italic>Bacillus licheniformis</italic> strain producing a bacteriocin-like substance</article-title>
					<source>Journal of Microbiology</source>
					<volume>50</volume>
					<fpage>452</fpage>
					<lpage>458</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1007/s12275-012-2051-3">https://doi.org/10.1007/s12275-012-2051-3</ext-link>
					</comment>
				</element-citation>
				<mixed-citation>Guo, Y.; Yu, Z.; Xie, J. and Zhang, R. 2012. Identification of a new <italic>Bacillus licheniformis</italic> strain producing a bacteriocin-like substance. Journal of Microbiology 50:452-458. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1007/s12275-012-2051-3">https://doi.org/10.1007/s12275-012-2051-3</ext-link>
				</mixed-citation>
			</ref>
			<ref id="B10">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Halonen</surname>
							<given-names>M.</given-names>
						</name>
						<name>
							<surname>Lohman</surname>
							<given-names>I. C.</given-names>
						</name>
						<name>
							<surname>Stern</surname>
							<given-names>D. A.</given-names>
						</name>
						<name>
							<surname>Spangenberg</surname>
							<given-names>A.</given-names>
						</name>
						<name>
							<surname>Anderson</surname>
							<given-names>D.</given-names>
						</name>
						<name>
							<surname>Mobley</surname>
							<given-names>S.</given-names>
						</name>
						<name>
							<surname>Ciano</surname>
							<given-names>K.</given-names>
						</name>
						<name>
							<surname>Peck</surname>
							<given-names>M.</given-names>
						</name>
						<name>
							<surname>Wright</surname>
							<given-names>A. L.</given-names>
						</name>
					</person-group>
					<year>2009</year>
					<article-title>Th1/Th2 patterns and balance in cytokine production in the parents and infants of a large birth cohort</article-title>
					<source>Journal of Immunology</source>
					<volume>182</volume>
					<fpage>3285</fpage>
					<lpage>3293</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.4049/jimmunol.0711996">https://doi.org/10.4049/jimmunol.0711996</ext-link>
					</comment>
				</element-citation>
				<mixed-citation>Halonen, M.; Lohman, I. C.; Stern, D. A.; Spangenberg, A.; Anderson, D.; Mobley, S.; Ciano, K.; Peck, M. and Wright, A. L. 2009. Th1/Th2 patterns and balance in cytokine production in the parents and infants of a large birth cohort. Journal of Immunology 182:3285-3293. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.4049/jimmunol.0711996">https://doi.org/10.4049/jimmunol.0711996</ext-link>
				</mixed-citation>
			</ref>
			<ref id="B11">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Hölker</surname>
							<given-names>U.</given-names>
						</name>
						<name>
							<surname>Lenz</surname>
							<given-names>J.</given-names>
						</name>
					</person-group>
					<year>2005</year>
					<article-title>Solid-state fermentation-are there any biotechnological advantages?</article-title>
					<source>Current Opinion in Microbiology</source>
					<volume>8</volume>
					<fpage>301</fpage>
					<lpage>306</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1016/j.mib.2005.04.006">https://doi.org/10.1016/j.mib.2005.04.006</ext-link>
					</comment>
				</element-citation>
				<mixed-citation>Hölker, U. and Lenz, J. 2005. Solid-state fermentation-are there any biotechnological advantages? Current Opinion in Microbiology 8:301-306. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1016/j.mib.2005.04.006">https://doi.org/10.1016/j.mib.2005.04.006</ext-link>
				</mixed-citation>
			</ref>
			<ref id="B12">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Jayaraman</surname>
							<given-names>S.</given-names>
						</name>
						<name>
							<surname>Thangavel</surname>
							<given-names>G.</given-names>
						</name>
						<name>
							<surname>Kurian</surname>
							<given-names>H.</given-names>
						</name>
						<name>
							<surname>Mani</surname>
							<given-names>R.</given-names>
						</name>
						<name>
							<surname>Mukkalil</surname>
							<given-names>R.</given-names>
						</name>
						<name>
							<surname>Chirakkal</surname>
							<given-names>H.</given-names>
						</name>
					</person-group>
					<year>2013</year>
					<article-title><italic>Bacillus subtilis</italic> PB6 improves intestinal health of broiler chickens challenged with <italic>Clostridium perfringens</italic>-induced necrotic enteritis</article-title>
					<source>Poultry Science</source>
					<volume>92</volume>
					<fpage>370</fpage>
					<lpage>374</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3382/ps.2012-02528">https://doi.org/10.3382/ps.2012-02528</ext-link>
					</comment>
				</element-citation>
				<mixed-citation>Jayaraman, S.; Thangavel, G.; Kurian, H.; Mani, R.; Mukkalil, R. and Chirakkal, H. 2013. <italic>Bacillus subtilis</italic> PB6 improves intestinal health of broiler chickens challenged with <italic>Clostridium perfringens</italic>-induced necrotic enteritis. Poultry Science 92:370-374. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3382/ps.2012-02528">https://doi.org/10.3382/ps.2012-02528</ext-link>
				</mixed-citation>
			</ref>
			<ref id="B13">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Kaldhusdal</surname>
							<given-names>M.</given-names>
						</name>
						<name>
							<surname>Løvland</surname>
							<given-names>A.</given-names>
						</name>
					</person-group>
					<year>2000</year>
					<article-title>The economical impact of <italic>Clostridium perfringens</italic> is greater than anticipated</article-title>
					<source>World Poultry</source>
					<volume>16</volume>
					<fpage>50</fpage>
					<lpage>51</lpage>
				</element-citation>
				<mixed-citation>Kaldhusdal, M. and Løvland, A. 2000. The economical impact of <italic>Clostridium perfringens</italic> is greater than anticipated. World Poultry 16:50-51.</mixed-citation>
			</ref>
			<ref id="B14">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Kayalvizhi</surname>
							<given-names>N.</given-names>
						</name>
						<name>
							<surname>Gunasekaran</surname>
							<given-names>P.</given-names>
						</name>
					</person-group>
					<year>2008</year>
					<article-title>Production and characterization of a low-molecular-weight bacteriocin from <italic>Bacillus licheniformis</italic> MKU3</article-title>
					<source>Letters in Applied Microbiology</source>
					<volume>47</volume>
					<fpage>600</fpage>
					<lpage>607</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1111/j.1472-765X.2008.02473.x">https://doi.org/10.1111/j.1472-765X.2008.02473.x</ext-link>
					</comment>
				</element-citation>
				<mixed-citation>Kayalvizhi, N. and Gunasekaran, P. 2008. Production and characterization of a low-molecular-weight bacteriocin from <italic>Bacillus licheniformis</italic> MKU3. Letters in Applied Microbiology 47:600-607. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1111/j.1472-765X.2008.02473.x">https://doi.org/10.1111/j.1472-765X.2008.02473.x</ext-link>
				</mixed-citation>
			</ref>
			<ref id="B15">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Keyburn</surname>
							<given-names>A. L.</given-names>
						</name>
						<name>
							<surname>Boyce</surname>
							<given-names>J. D.</given-names>
						</name>
						<name>
							<surname>Vaz</surname>
							<given-names>P.</given-names>
						</name>
						<name>
							<surname>Bannam</surname>
							<given-names>T. L.</given-names>
						</name>
						<name>
							<surname>Ford</surname>
							<given-names>M. E.</given-names>
						</name>
						<name>
							<surname>Parker</surname>
							<given-names>D.</given-names>
						</name>
						<name>
							<surname>Di Rubbo</surname>
							<given-names>A.</given-names>
						</name>
						<name>
							<surname>Rood</surname>
							<given-names>J. I.</given-names>
						</name>
						<name>
							<surname>Moore</surname>
							<given-names>R. J.</given-names>
						</name>
					</person-group>
					<year>2008</year>
					<article-title>NetB, a new toxin that is associated with avian necrotic enteritis caused by <italic>Clostridium perfringens</italic></article-title>
					<source>PLOS Pathogens</source>
					<volume>4</volume>
					<elocation-id>e26</elocation-id>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1371/journal.ppat.0040026">https://doi.org/10.1371/journal.ppat.0040026</ext-link>
					</comment>
				</element-citation>
				<mixed-citation>Keyburn, A. L.; Boyce, J. D.; Vaz, P.; Bannam, T. L.; Ford, M. E.; Parker, D.; Di Rubbo, A.; Rood, J. I. and Moore, R. J. 2008. NetB, a new toxin that is associated with avian necrotic enteritis caused by <italic>Clostridium perfringens</italic>. PLOS Pathogens 4:e26. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1371/journal.ppat.0040026">https://doi.org/10.1371/journal.ppat.0040026</ext-link>
				</mixed-citation>
			</ref>
			<ref id="B16">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Kiers</surname>
							<given-names>J. L.</given-names>
						</name>
						<name>
							<surname>Van Laeken</surname>
							<given-names>A. E. A.</given-names>
						</name>
						<name>
							<surname>Rombouts</surname>
							<given-names>F. M.</given-names>
						</name>
						<name>
							<surname>Nout</surname>
							<given-names>M. J. R.</given-names>
						</name>
					</person-group>
					<year>2000</year>
					<article-title><italic>In vitro</italic> digestibility of <italic>Bacillus</italic> fermented soya bean</article-title>
					<source>International Journal of Food Microbiology</source>
					<volume>60</volume>
					<fpage>163</fpage>
					<lpage>169</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1016/S0168-1605(00)00308-1">https://doi.org/10.1016/S0168-1605(00)00308-1</ext-link>
					</comment>
				</element-citation>
				<mixed-citation>Kiers, J. L.; Van Laeken, A. E. A.; Rombouts, F. M. and Nout, M. J. R. 2000. <italic>In vitro</italic> digestibility of <italic>Bacillus</italic> fermented soya bean. International Journal of Food Microbiology 60:163-169. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1016/S0168-1605(00)00308-1">https://doi.org/10.1016/S0168-1605(00)00308-1</ext-link>
				</mixed-citation>
			</ref>
			<ref id="B17">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Kidd</surname>
							<given-names>P.</given-names>
						</name>
					</person-group>
					<year>2003</year>
					<article-title>Th1/Th2 balance: the hypothesis, its limitations, and implications for health and disease</article-title>
					<source>Alternative Medicine Review</source>
					<volume>8</volume>
					<fpage>223</fpage>
					<lpage>246</lpage>
				</element-citation>
				<mixed-citation>Kidd, P. 2003. Th1/Th2 balance: the hypothesis, its limitations, and implications for health and disease. Alternative Medicine Review 8:223-246.</mixed-citation>
			</ref>
			<ref id="B18">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Knap</surname>
							<given-names>I.</given-names>
						</name>
						<name>
							<surname>Lund</surname>
							<given-names>B.</given-names>
						</name>
						<name>
							<surname>Kehlet</surname>
							<given-names>A. B.</given-names>
						</name>
						<name>
							<surname>Hofacre</surname>
							<given-names>C.</given-names>
						</name>
						<name>
							<surname>Mathis</surname>
							<given-names>G.</given-names>
						</name>
					</person-group>
					<year>2010</year>
					<article-title><italic>Bacillus licheniformis</italic> prevents necrotic enteritis in broiler chickens</article-title>
					<source>Avian Diseases</source>
					<volume>54</volume>
					<fpage>931</fpage>
					<lpage>936</lpage>
				</element-citation>
				<mixed-citation>Knap, I.; Lund, B.; Kehlet, A. B.; Hofacre, C. and Mathis, G. 2010. <italic>Bacillus licheniformis</italic> prevents necrotic enteritis in broiler chickens. Avian Diseases 54:931-936.</mixed-citation>
			</ref>
			<ref id="B19">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Krishna</surname>
							<given-names>C.</given-names>
						</name>
					</person-group>
					<year>2005</year>
					<article-title>Solid-state fermentation systems–An overview</article-title>
					<source>Critical Reviews in Biotechnology</source>
					<volume>25</volume>
					<fpage>1</fpage>
					<lpage>30</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1080/07388550590925383">https://doi.org/10.1080/07388550590925383</ext-link>
					</comment>
				</element-citation>
				<mixed-citation>Krishna, C. 2005. Solid-state fermentation systems–An overview. Critical Reviews in Biotechnology 25:1-30. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1080/07388550590925383">https://doi.org/10.1080/07388550590925383</ext-link>
				</mixed-citation>
			</ref>
			<ref id="B20">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>La Ragione</surname>
							<given-names>R. M.</given-names>
						</name>
						<name>
							<surname>Woodward</surname>
							<given-names>M. J.</given-names>
						</name>
					</person-group>
					<year>2003</year>
					<article-title>Competitive exclusion by <italic>Bacillus subtilis</italic> spores of <italic>Salmonella enterica</italic> serotype Enteritidis and <italic>Clostridium perfringens</italic> in young chickens</article-title>
					<source>Veterinary Microbiology</source>
					<volume>94</volume>
					<fpage>245</fpage>
					<lpage>256</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1016/S0378-1135(03)00077-4">https://doi.org/10.1016/S0378-1135(03)00077-4</ext-link>
					</comment>
				</element-citation>
				<mixed-citation>La Ragione, R. M. and Woodward, M. J. 2003. Competitive exclusion by <italic>Bacillus subtilis</italic> spores of <italic>Salmonella enterica</italic> serotype Enteritidis and <italic>Clostridium perfringens</italic> in young chickens. Veterinary Microbiology 94:245-256. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1016/S0378-1135(03)00077-4">https://doi.org/10.1016/S0378-1135(03)00077-4</ext-link>
				</mixed-citation>
			</ref>
			<ref id="B21">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Lee</surname>
							<given-names>K. W.</given-names>
						</name>
						<name>
							<surname>Lillehoj</surname>
							<given-names>H. S.</given-names>
						</name>
						<name>
							<surname>Jeong</surname>
							<given-names>W.</given-names>
						</name>
						<name>
							<surname>Jeoung</surname>
							<given-names>H. Y.</given-names>
						</name>
						<name>
							<surname>An</surname>
							<given-names>D. J.</given-names>
						</name>
					</person-group>
					<year>2011</year>
					<article-title>Avian necrotic enteritis: experimental models, host immunity, pathogenesis, risk factors, and vaccine development</article-title>
					<source>Poultry Science</source>
					<volume>90</volume>
					<fpage>1381</fpage>
					<lpage>1390</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3382/ps.2010-01319">https://doi.org/10.3382/ps.2010-01319</ext-link>
					</comment>
				</element-citation>
				<mixed-citation>Lee, K. W.; Lillehoj, H. S.; Jeong, W.; Jeoung, H. Y. and An, D. J. 2011. Avian necrotic enteritis: experimental models, host immunity, pathogenesis, risk factors, and vaccine development. Poultry Science 90:1381-1390. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3382/ps.2010-01319">https://doi.org/10.3382/ps.2010-01319</ext-link>
				</mixed-citation>
			</ref>
			<ref id="B22">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Liu</surname>
							<given-names>X.</given-names>
						</name>
						<name>
							<surname>Yan</surname>
							<given-names>H.</given-names>
						</name>
						<name>
							<surname>Lv</surname>
							<given-names>L.</given-names>
						</name>
						<name>
							<surname>Xu</surname>
							<given-names>Q.</given-names>
						</name>
						<name>
							<surname>Yin</surname>
							<given-names>C.</given-names>
						</name>
						<name>
							<surname>Zhang</surname>
							<given-names>K.</given-names>
						</name>
						<name>
							<surname>Wang</surname>
							<given-names>P.</given-names>
						</name>
						<name>
							<surname>Hu</surname>
							<given-names>J.</given-names>
						</name>
					</person-group>
					<year>2012</year>
					<article-title>Growth performance and meat quality of broiler chickens supplemented with <italic>Bacillus licheniformis</italic> in drinking water</article-title>
					<source>Asian-Australasian Journal of Animal Sciences</source>
					<volume>25</volume>
					<fpage>682</fpage>
					<lpage>689</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.5713%2Fajas.2011.11334">https://doi.org/10.5713%2Fajas.2011.11334</ext-link>
					</comment>
				</element-citation>
				<mixed-citation>Liu, X.; Yan, H.; Lv, L.; Xu, Q.; Yin, C.; Zhang, K.; Wang, P. and Hu, J. 2012. Growth performance and meat quality of broiler chickens supplemented with <italic>Bacillus licheniformis</italic> in drinking water. Asian-Australasian Journal of Animal Sciences 25:682-689. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.5713%2Fajas.2011.11334">https://doi.org/10.5713%2Fajas.2011.11334</ext-link>
				</mixed-citation>
			</ref>
			<ref id="B23">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Lutful Kabir</surname>
							<given-names>S. M.</given-names>
						</name>
					</person-group>
					<year>2009</year>
					<article-title>The role of probiotics in the poultry industry</article-title>
					<source>International Journal of Molecular Sciences</source>
					<volume>10</volume>
					<fpage>3531</fpage>
					<lpage>3546</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3390%2Fijms10083531">https://doi.org/10.3390%2Fijms10083531</ext-link>
					</comment>
				</element-citation>
				<mixed-citation>Lutful Kabir, S. M. 2009. The role of probiotics in the poultry industry. International Journal of Molecular Sciences 10:3531-3546. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3390%2Fijms10083531">https://doi.org/10.3390%2Fijms10083531</ext-link>
				</mixed-citation>
			</ref>
			<ref id="B24">
				<element-citation publication-type="book">
					<person-group person-group-type="author">
						<collab>NRC - National Research Council</collab>
					</person-group>
					<year>1994</year>
					<source>Nutrient requirements of poultry</source>
					<edition>9th ed.</edition>
					<publisher-name>National Academy Press</publisher-name>
					<publisher-loc>Washington, DC</publisher-loc>
				</element-citation>
				<mixed-citation>NRC - National Research Council. 1994. Nutrient requirements of poultry. 9th ed. National Academy Press, Washington, DC.</mixed-citation>
			</ref>
			<ref id="B25">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Patterson</surname>
							<given-names>J. A.</given-names>
						</name>
						<name>
							<surname>Burkholder</surname>
							<given-names>K. M.</given-names>
						</name>
					</person-group>
					<year>2003</year>
					<article-title>Application of prebiotics and probiotics in poultry production</article-title>
					<source>Poultry Science</source>
					<volume>82</volume>
					<fpage>627</fpage>
					<lpage>631</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1093/ps/82.4.627">https://doi.org/10.1093/ps/82.4.627</ext-link>
					</comment>
				</element-citation>
				<mixed-citation>Patterson, J. A. and Burkholder, K. M. 2003. Application of prebiotics and probiotics in poultry production. Poultry Science 82:627-631. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1093/ps/82.4.627">https://doi.org/10.1093/ps/82.4.627</ext-link>
				</mixed-citation>
			</ref>
			<ref id="B26">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Pattnaik</surname>
							<given-names>P.</given-names>
						</name>
						<name>
							<surname>Kaushik</surname>
							<given-names>J. K.</given-names>
						</name>
						<name>
							<surname>Grover</surname>
							<given-names>S.</given-names>
						</name>
						<name>
							<surname>Batish</surname>
							<given-names>V. K.</given-names>
						</name>
					</person-group>
					<year>2001</year>
					<article-title>Purification and characterization of a bacteriocin-like compound (lichenin) produced anaerobically by <italic>Bacillus licheniformis</italic> isolated from water buffalo</article-title>
					<source>Journal of Applied Microbiology</source>
					<volume>91</volume>
					<fpage>636</fpage>
					<lpage>645</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1046/j.1365-2672.2001.01429.x">https://doi.org/10.1046/j.1365-2672.2001.01429.x</ext-link>
					</comment>
				</element-citation>
				<mixed-citation>Pattnaik, P.; Kaushik, J. K.; Grover, S. and Batish, V. K. 2001. Purification and characterization of a bacteriocin-like compound (lichenin) produced anaerobically by <italic>Bacillus licheniformis</italic> isolated from water buffalo. Journal of Applied Microbiology 91:636-645. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1046/j.1365-2672.2001.01429.x">https://doi.org/10.1046/j.1365-2672.2001.01429.x</ext-link>
				</mixed-citation>
			</ref>
			<ref id="B27">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Pieniz</surname>
							<given-names>S.</given-names>
						</name>
						<name>
							<surname>Andreazza</surname>
							<given-names>R.</given-names>
						</name>
						<name>
							<surname>Anghinoni</surname>
							<given-names>T.</given-names>
						</name>
						<name>
							<surname>Camargo</surname>
							<given-names>F.</given-names>
						</name>
						<name>
							<surname>Brandelli</surname>
							<given-names>A.</given-names>
						</name>
					</person-group>
					<year>2014</year>
					<article-title>Probiotic potential, antimicrobial and antioxidant activities of <italic>Enterococcus durans</italic> strain LAB18s</article-title>
					<source>Food Control</source>
					<volume>37</volume>
					<fpage>251</fpage>
					<lpage>256</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1016/j.foodcont.2013.09.055">https://doi.org/10.1016/j.foodcont.2013.09.055</ext-link>
					</comment>
				</element-citation>
				<mixed-citation>Pieniz, S.; Andreazza, R.; Anghinoni, T.; Camargo, F. and Brandelli, A. 2014. Probiotic potential, antimicrobial and antioxidant activities of <italic>Enterococcus durans</italic> strain LAB18s. Food Control 37:251-256. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1016/j.foodcont.2013.09.055">https://doi.org/10.1016/j.foodcont.2013.09.055</ext-link>
				</mixed-citation>
			</ref>
			<ref id="B28">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Tactacan</surname>
							<given-names>G. B.</given-names>
						</name>
						<name>
							<surname>Schmidt</surname>
							<given-names>J. K.</given-names>
						</name>
						<name>
							<surname>Miille</surname>
							<given-names>M. J.</given-names>
						</name>
						<name>
							<surname>Jimenez</surname>
							<given-names>D. R.</given-names>
						</name>
					</person-group>
					<year>2013</year>
					<article-title>A <italic>Bacillus subtilis</italic> (QST 713) spore-based probiotic for necrotic enteritis control in broiler chickens</article-title>
					<source>Journal of Applied Poultry Research</source>
					<volume>22</volume>
					<fpage>825</fpage>
					<lpage>831</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3382/japr.2013-00730">https://doi.org/10.3382/japr.2013-00730</ext-link>
					</comment>
				</element-citation>
				<mixed-citation>Tactacan, G. B.; Schmidt, J. K.; Miille, M. J. and Jimenez, D. R. 2013. A <italic>Bacillus subtilis</italic> (QST 713) spore-based probiotic for necrotic enteritis control in broiler chickens. Journal of Applied Poultry Research 22:825-831. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3382/japr.2013-00730">https://doi.org/10.3382/japr.2013-00730</ext-link>
				</mixed-citation>
			</ref>
			<ref id="B29">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Timbermont</surname>
							<given-names>L.</given-names>
						</name>
						<name>
							<surname>Haesebrouck</surname>
							<given-names>F.</given-names>
						</name>
						<name>
							<surname>Ducatelle</surname>
							<given-names>R.</given-names>
						</name>
						<name>
							<surname>Van Immerseel</surname>
							<given-names>F.</given-names>
						</name>
					</person-group>
					<year>2011</year>
					<article-title>Necrotic enteritis in broilers: an updated review on the pathogenesis</article-title>
					<source>Avian Pathology</source>
					<volume>40</volume>
					<fpage>341</fpage>
					<lpage>347</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1080/03079457.2011.590967">https://doi.org/10.1080/03079457.2011.590967</ext-link>
					</comment>
				</element-citation>
				<mixed-citation>Timbermont, L.; Haesebrouck, F.; Ducatelle, R. and Van Immerseel, F. 2011. Necrotic enteritis in broilers: an updated review on the pathogenesis. Avian Pathology 40:341-347. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1080/03079457.2011.590967">https://doi.org/10.1080/03079457.2011.590967</ext-link>
				</mixed-citation>
			</ref>
			<ref id="B30">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Van der Sluis</surname>
							<given-names>W.</given-names>
						</name>
					</person-group>
					<year>2000</year>
					<article-title>Clostridial enteritis is often an underestimated problem</article-title>
					<source>World Poultry</source>
					<volume>16</volume>
					<fpage>42</fpage>
					<lpage>43</lpage>
				</element-citation>
				<mixed-citation>Van der Sluis, W. 2000. Clostridial enteritis is often an underestimated problem. World Poultry 16:42-43.</mixed-citation>
			</ref>
			<ref id="B31">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Van Immerseel</surname>
							<given-names>F.</given-names>
						</name>
						<name>
							<surname>De Buck</surname>
							<given-names>J.</given-names>
						</name>
						<name>
							<surname>Pasmans</surname>
							<given-names>F.</given-names>
						</name>
						<name>
							<surname>Huyghebaert</surname>
							<given-names>G.</given-names>
						</name>
						<name>
							<surname>Haesebrouck</surname>
							<given-names>F.</given-names>
						</name>
						<name>
							<surname>Ducatelle</surname>
							<given-names>R.</given-names>
						</name>
					</person-group>
					<year>2004</year>
					<article-title><italic>Clostridium perfringens</italic> in poultry: an emerging threat for animal and public health</article-title>
					<source>Avian Pathology</source>
					<volume>33</volume>
					<fpage>537</fpage>
					<lpage>549</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1080/03079450400013162">https://doi.org/10.1080/03079450400013162</ext-link>
					</comment>
				</element-citation>
				<mixed-citation>Van Immerseel, F.; De Buck, J.; Pasmans, F.; Huyghebaert, G.; Haesebrouck, F. and Ducatelle, R. 2004. <italic>Clostridium perfringens</italic> in poultry: an emerging threat for animal and public health. Avian Pathology 33:537-549. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1080/03079450400013162">https://doi.org/10.1080/03079450400013162</ext-link>
				</mixed-citation>
			</ref>
			<ref id="B32">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Yakimov</surname>
							<given-names>M. M.</given-names>
						</name>
						<name>
							<surname>Timmis</surname>
							<given-names>K. N.</given-names>
						</name>
						<name>
							<surname>Wray</surname>
							<given-names>V.</given-names>
						</name>
						<name>
							<surname>Fredrickson</surname>
							<given-names>H. L.</given-names>
						</name>
					</person-group>
					<year>1995</year>
					<article-title>Characterization of a new lipopeptide surfactant produced by thermotolerant and halotolerant subsurface <italic>Bacillus licheniformis</italic> BAS50</article-title>
					<source>Applied and Environmental Microbiology</source>
					<volume>61</volume>
					<fpage>1706</fpage>
					<lpage>1713</lpage>
				</element-citation>
				<mixed-citation>Yakimov, M. M.; Timmis, K. N.; Wray, V. and Fredrickson, H. L. 1995. Characterization of a new lipopeptide surfactant produced by thermotolerant and halotolerant subsurface <italic>Bacillus licheniformis</italic> BAS50. Applied and Environmental Microbiology 61:1706-1713.</mixed-citation>
			</ref>
			<ref id="B33">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Zhao</surname>
							<given-names>S.</given-names>
						</name>
						<name>
							<surname>Hu</surname>
							<given-names>N.</given-names>
						</name>
						<name>
							<surname>Huang</surname>
							<given-names>J.</given-names>
						</name>
						<name>
							<surname>Liang</surname>
							<given-names>Y.</given-names>
						</name>
						<name>
							<surname>Zhao</surname>
							<given-names>B.</given-names>
						</name>
					</person-group>
					<year>2008</year>
					<article-title>High-yield spore production from <italic>Bacillus licheniformis</italic> by solid state fermentation</article-title>
					<source>Biotechnology Letters</source>
					<volume>30</volume>
					<fpage>295</fpage>
					<lpage>297</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1007/s10529-007-9540-1">https://doi.org/10.1007/s10529-007-9540-1</ext-link>
					</comment>
				</element-citation>
				<mixed-citation>Zhao, S.; Hu, N.; Huang, J.; Liang, Y. and Zhao, B. 2008. High-yield spore production from <italic>Bacillus licheniformis</italic> by solid state fermentation. Biotechnology Letters 30:295-297. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1007/s10529-007-9540-1">https://doi.org/10.1007/s10529-007-9540-1</ext-link>
				</mixed-citation>
			</ref>
			<ref id="B34">
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Zhou</surname>
							<given-names>M.</given-names>
						</name>
						<name>
							<surname>Zeng</surname>
							<given-names>D.</given-names>
						</name>
						<name>
							<surname>Ni</surname>
							<given-names>X.</given-names>
						</name>
						<name>
							<surname>Tu</surname>
							<given-names>T.</given-names>
						</name>
						<name>
							<surname>Yin</surname>
							<given-names>Z.</given-names>
						</name>
						<name>
							<surname>Pan</surname>
							<given-names>K.</given-names>
						</name>
						<name>
							<surname>Jing</surname>
							<given-names>B.</given-names>
						</name>
					</person-group>
					<year>2016</year>
					<article-title>Effects of <italic>Bacillus licheniformis</italic> on the growth performance and expression of lipid metabolism-related genes in broiler chickens challenged with <italic>Clostridium perfringens</italic>-induced necrotic enteritis</article-title>
					<source>Lipids in Health and Disease</source>
					<volume>15</volume>
					<fpage>48</fpage>
					<lpage>48</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1186/s12944-016-0219-2">https://doi.org/10.1186/s12944-016-0219-2</ext-link>
					</comment>
				</element-citation>
				<mixed-citation>Zhou, M.; Zeng, D.; Ni, X.; Tu, T.; Yin, Z.; Pan, K. and Jing, B. 2016. Effects of <italic>Bacillus licheniformis</italic> on the growth performance and expression of lipid metabolism-related genes in broiler chickens challenged with <italic>Clostridium perfringens</italic>-induced necrotic enteritis. Lipids in Health and Disease 15:48. <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1186/s12944-016-0219-2">https://doi.org/10.1186/s12944-016-0219-2</ext-link>
				</mixed-citation>
			</ref>
		</ref-list>
	</back>
</article>